Справочник врача 21

Поиск по медицинской литературе


Y-хромосома




XY – поддерживать равное соотношение полов для повышения биологического разнообразия. Система X0 присутствует у некоторых насекомых, самки имеют две половых хромосомы, самцы – одну. Прямо противоположная картина наблюдается у тли. При наличии двух половых хромосом различают ZW и XY системы определения пола. Если гетерогаметным полом, т. е. полом, в мейозе которого образуются гаметы с разным набором половых хромосом, является женский (например, птицы, некоторые рептилии), система называется ZW (рис. 63). При системе XY (например, дрозофила, плацентарные млекопитающие) гетерогаметным полом являются самцы (рис. 63). Интересно, что в последнем случае пол может определяться как присутствием Y-хромосомы, как у плацентарных млекопитающих, так и соотношением числа аутосом и числа X-хромосом (балансовый тип), как у дрозофилы. У дрозофилы при диплоидном наборе аутосом и наличии одной X-хромосомы формируются самцы безотносительно наличия и количества Y-хромосом. Присутствие двух Xхромосом на диплоидный набор ведет к развитию самок, чему не препятствует наличие Y-хромосомы. У плацентарных млекопитающих присутствие одной или более Y-хромосомы приводит к формированию мужского пола, несмотря на любые иные обстоятельства. Это объясняется наличием в Y-хромосоме гена TDF-SRY, определяющего развитие по мужскому пути (рис. 63). При транслокациях участка Y-хромосомы, содержащего этот ген, на X-хромосому у человека встречались мужчины с набором хромосом 46, XX и женщины с набором хромосом 46, XY. [стр. 116 ⇒]

Как уже говорилось выше, при скрещивании белоглазых самок дрозофилы с красноглазыми самцами в F1 все самки были красноглазыми, а самцы белоглазыми. Однако, редко, не чаще одного раза на 2000 случаев, в таких скрещиваниях появляются исключительно белоглазые самки и красноглазые самцы. Эти случаи были детально исследованы К.Бриджесом (1916 г.), который показал, что данные отклонения объясняются нарушениями мейоза и связаны с нерасхождением Х хромосом. Результатом является образование яйцеклеток с двумя Ххромосомами и яйцеклеток вообще без Х-хромосом (рис. 8.5). При оплодотворении этих яйцеклеток спермиями с Х и Y хромосомами возможно образование четырех типов зигот: с тремя Х-хромосомами (обычно погибают), с одной отцовской Ххромосомой, с двумя материнскими Х-хромосомами и одной Y хромосомой и одной Y хромосомой (всегда погибают). Из зигот с одной отцовской Х хромосомой развиваются красноглазые самцы (стерильны), а из зигот с двумя материнскими Х хромосомами и Y хромосомой – белоглазые самки (фертильны). [стр. 102 ⇒]

Фертильность самок с двумя Х хромосомами и одной Y хромосомой, позволила К.Бриджесу продолжать эксперименты. Он скрещивал таких самок с нормальными красноглазыми самцами (рис. 8.6). В результате, как можно видеть на рис. 8.6, происходит образование восьми типов зигот: 1 – с двумя Х хромосомами (материнская и отцовская), из которых в дальнейшем развиваются нормальные красноглазые самки; 2 – с двумя Х хромосомами (материнская и отцовская) и одной Y хромосомой (от белоглазой самки), из которых развиваются красноглазые самки; 3 – c тремя Х хромосомами (две от матери и одна от отца), такие зиготы обычно погибают; 4 – с одной Х хромосомой (отцовской) и Y хромосомой от белоглазой матери, из них развиваются красноглазые самцы (4%); 5 – с одной Х хромосомой (материнской) и Y хромосомой отцовской, из которых развиваются белоглазые самцы; 6 – с одной Х хромосомой (материнской) и двумя Y хромосомами (материнская... [стр. 102 ⇒]

Многие признаки у человека наследуются сцеплено с половыми хромосомами. Локализованные в половых хромосомах гены имеют свои особенности передачи в поколениях. Например, сцепленно с Х-хромосомой наследуются гемофилия, дальтонизм и др., с Y-хромосомой – ген облысения, гипертрихоза (рост волос в ушной раковине) и др. Так как Х- и Y-хромосомы наряду с гомологичными участками имеют и негомологичные, при решении задач на такое наследование необходимо учитывать в какой из половых хромосом располагается соответствующий ген, в Х- или в Y-хромосоме. Запись удобнее вести с изображением половых хромосом. Например, Хh – ген гемофилии, сцепленный с Х-хромосомой. В Y-хромосоме гена гемофилии нет. Поэтому возможные генотипы людей по этому признаку могут быть такими:... [стр. 29 ⇒]

Понижение перекреста между X- и Y-хромосомами приводит к постоянной, вынужденной гетерозиготности Yхромосомы. Интенсивность отбора по отношению к мутациям, возникающим в Y-хромосоме, понижена по сравнению с интенсивностью отбора по отношению к мутациям, возникающим в других хромосомах. Это ведет к «опустению» Y-хромосомы [Muller, 1918; Darlington, 1932; Muller, Painter, 1932; Haldane, 1933]. У растений, где гаплофаза значительно сильнее развита, чем у животных, отбор в гаплофазе мутаций, возникающих в Y-хромосоме, препятствует возникновению резких различий между X- и Y-хромосомами. Гетерозиштность Y-хромосомы ограничена диплофазой. В соответствии с этим эволюция хромосомного механизма реализации пола находится у растений на более примитивной стадии, чем у животных. Однако и здесь найдены случаи резких различий между X- и Y-хромосомами у мха Sphaerocarpus [Allen, 1917, 1932], где X- и Y-хромосома находятся в диплофазе в состоянии постоянной гетерозиготности. Это показывает, какие глубокие последствия может иметь даже ограниченное диплофазой понижение... [стр. 45 ⇒]

Мужчина и женщина отличаются друг от друга: 1) комплексом физиологических и биохимических признаков; 2) наличием Y-хромосомы только в геноме мужчины; 3) наличием отцовской Х-хромосомы только в геноме женщины. Ни одно из этих отличий не является причиной отличий полов по половому хроматину. Женщина, страдающая синдромом ТернераШерешевского, имеющая одну Х-хромосому (ХО) не имеет полового хроматина, независимо от того, получила ли она свою Х-хромосому заведомо от отца (если нерасхождение половых хромосом произошло в онтогенезе матери) или от матери (если нерасхождение произошло в сперматогенезе отца). Мужчина с синдромом Клейнфельтера, имеющий две Х-хромосомы и Y-хромосому (XXY), имеет половой хроматин также вне зависимости от того, получил ли он две Х-хромосомы от матери и Y-хромосому от отца или унаследовал от матери одну Х-хромосому, а от отца две другие хромосомы — X и Y [Barr, Carr, 1962]. Отсюда следует, что наличие деспирализованной Х-хромосомы служит препятствием к деспирализации второго партнера. Вступление активной Х-хромосомы в митотический цикл, т. е. спирализация, служит сигналом к деспирализации гомологичной Х-хромосомы, которая получает возможность редупликации. Двойной половой хроматин возникает тогда, когда одна хромосома переходит из... [стр. 62 ⇒]

То же самое удалось сделать и с Y-хромосомой. Я уже говорил, что Х0 самцы морфофизиологически совершенно нормальны, только абсолютно стерильны. Оказалось, что Y-хромосома определяет не пол как таковой, а жизнеспособность и плодовитость спермиев. Сперматогенез у Х0-самцов протекает ненормально, и спермии оказываются не способными к оплодотворению. Так вот, опять-таки в результате разломов Y-хромосом можно было получить куски Y-хромосомы, она такая неравноплечная хромосомка. И оказалось, что нужна далеко не вся Yхромосома, а спермии становятся плодовитыми, если имеются определенные куски, где сидят какие-то факторы плодовитости. Если с помощью транслокации прицепить эти куски Y-хромосомы на какую-нибудь другую, то все оказывается в порядке. Удалось и в Y-хромосоме локализовать факторы мужской фертильности у дрозофилы. [стр. 38 ⇒]

Цитогенетический анализ показывает наличие в 2/3 случаев кариотипа 45,Х/46,XY и в 1/3 - кариотипа 46,XY Направление полового развития зависит от количества клеток с кариотипом 46,XY Митотическая потеря хромосомы Y во время раннего эмбрионального развития объясняет наличие мозаицизма 45,Х/46,XY в кариотипе таких пациентов (Maduro and Lamb, 2002). Фенотип варьирует в зависимости от уровня мозаицизма, который определяется моментом митотической ошибки в эмбриональном периоде, а также соотношением клеточной линии с аномальным кариотипом к клеточной линии с нормальным кариотипом (KentFirst, 2000). Поскольку смешанная гонадальная дисгенезия сопровождается как мозаичным вариантом, так и нормальным мужским кариотипом, принято считать, что этиология синдрома неоднородна, и неполное развитие яичек может происходить в результате ошибок во время детерминации пола или половой дифференцировки, что рассмотрено ниже. Известны следующие структурные аномалии половых хромосом при бесплодии у мужчин: структурные аномалии хромосомы Y хромосомы X, реципрокные транслокации гоносом, гоносом и аутосом. В большинстве случаев при бесплодии у мужчин наблюдают аберрации хромосомы Y Среди них известны следующие: делеция короткого плеча хромосомы Y делеция длинного плеча хромосомы Y кольцевая хромосома Y изо- или изодицентрическая хромосома по 118... [стр. 117 ⇒]

Для пренатальной диагностики хромосомных дисбалансов, особенно при беременностях женщин зрелого возраста или уже родивших ребенка с хромосомными нарушениями, широко используются пригодные для культивирования клетки амниотической жидкости и клетки фетального происхождения. Метафазные препараты можно приготовить также из ворсин хориона, биопсированных в Г триместре беременности. Исследование полового хроматина можно проводить, используя клетки ядра, которые находятся в интерфазе. Вероятно, наиболее доступны клетки слизистой оболочки ротовой полости и волосяных сумок, но полезными могут оказаться и клетки, полученные при хирургических операциях и аутопсии и культивированные. Х-хроматин (ранее называвшийся тельцами Барра) — это конденсированные тельца, присоединенные к ядерной мембране, состоящие из хроматина одной Х-хромосомы и присутствующие в нормальных женских клетках. В каждой конкретной клетке Х-хроматин образуется генетически инактивированной поздно реплицирующейся Х-хромосомой. Следовательно, число Х-хроматиновых тел служит показателем числа Х-хромосом сверх единицы. У-хроматин — предоминантно генетически инактивированный сегмент Y-хромосомы, обнаруживаемый окраской акридиновым красителем и флюоресцентной микроскопией,—присутствует в интерфазных ядрах Y-содержащих клеток (например, клетки 48, XXYY содержат одну Х-хроматиновую и две Y-хроматиновые массы). В неясных случаях бесплодия информативными оказываются препараты мейотическйх хромосом тестикулярного биоптата. С их помощью можно идентифицировать транслокации и генетически определяемые нарушения мейотического спаривания. Для определения более тонких хромосомных аномалий конвенционные цитогенетические методы могут дополняться техникой рекомбинантнои ДНК. При наличии соответствующих локус- или сегментспецифических зондов можно сказать, какие сегменты затронуты перестройкой, для обнаружения которой величины разрешения полосковой техники недостаточно. Зонды для ПДРФ (упоминавшиеся выше) иногда используются в пренатальной диагностике для идентификации происхождения той или иной хромосомы, унаследованной плодом. Это может оказаться эффективным при беременностях, сопровождаемых риском Х-сцепленных заболеваний, поскольку позволяет определить, является ли единственная Х-хромосома плода мужского пола той самой, которая несет конкретный болезнетворный локус, заведомо имеющийся в семье, как, например, в случаях мышечной дистрофии Дюшенна или гемофилии. Информативной может оказаться рекомбинантная техника и при условиях, сопровождающих доминатный тип наследования, как при хорее Гентингтона. В этом случае о наличии в геноме плода нежелательного мутантного гена судят по наличию ПДРФ, близко сцепленного с мутантным геном. В немногих случаях имеются зонды и для самих мутантных генов. Зондами, специфическими к Y-хромосоме, можно определять пол эмбриона или плода по немногим клеткам, полученным биопсией ворсин хориона или аминоцентезом. Этот метод имеет и диагностическую ценность в неясных случаях бисексуальности, позволяя обнаружить в геноме Y-хромосому или ее сегмент. В ряде случаев возникает необходимость проведения анализа хромосом в метафазе с целью нахождения повреждений генетического материала, вызванных внешними факторами (радиационное, химическое воздействия, вирус). Для поиска таких повреждений у конкретного индивида или у популяции в целом можно использовать клетки, пролиферирующие in vivo. Альтернативным методом является исследование культуры клеток, подвергающихся воздействию исследуемого агента для определения его способности к кластогенезу (т. е. ломке хромосом) или к индуцированию хроматидного обмена и перестроек. Тест-системой, менее громоздкой, чем метафазно-хромосамный анализ, но вполне пригодной для определения хромосомных ломок, происходящих как in vivo, так и in vitro, может служить определение пропорции доли клеток с микроядрами. Микроядро образуется, если фрагмент хромосомы без центромеры задерживается в анафазе (что обязательно и произойдет) и заключается в отдельное ядро в телефазе. Микроядерный анализ информативен и при исследовании кластогенной экспозиции популяций, которая эквивалентна мутагенной и карциногенной экспозиции. 214... [стр. 214 ⇒]

ГЕНЕТИКА без тайн дриальная ДНК пролила свет на наследование генов по материнской линии, так Y-хромосома проясняет передачу генов по отцовской линии. Это возможно благодаря тому, что Y-хромосома делает человека мужчиной. Исследования Дэвида Пейджа (David Page) и Брюса Лана (Bruce Lahn) из Чикагского университета показали, что Y-хромосома появилась в результате мутации около 300 млн лет назад (у наших предков-рептилий пол определялся не генами, а такими условиями внешней среды, как температура). За миллионы лет последующие мутации перестроили и укоротили гены Y-хромосомы до такой степени, что она больше не смогла обмениваться генами с Х-хромосомой во время мейоза, хотя обе они составляют пару 23 человеческих хромосом. Это означает, что единственным источником генетической изменчивости хромосомы стали мутации. Сравнивая специфические, наиболее подверженные изменениям фрагменты Y-хромосомы у мужчин из различных географических регионов, можно составить историческую картину, соответствующую «митохондриальной». [стр. 115 ⇒]

ГЛАВА 14 Люди: как генетика влияет на нас а у мужского пара хромосом XY, и в половых клетках может быть или Х-, или Y-хромосома. Самки — гомогаметные особи, а самцы — гетерогаметные. Мужские гаметы определяют пол эмбриона, образующегося после успешного оплодотворения яйцеклетки. Есть насекомые, птицы и рыбы, у которых самки бывают гетерогаметными, а самцы гомогаметны. Чтобы избежать путаницы, соответствующие хромосомы у этих видов называются Z и W , вместо X и Y. Один специфический ген, определяющий пол, был установлен. Ген SRY (по <определяющему пол региону Y») расположен на коротком плече Y-хромосомы и кодирует продукт, называемый TDI- ф а к т о р , д е т е р м и н и р у ю щ и й я и ч к и . В совокупности с другими генами он кодирует связывающийся с Д Н К белок, который, в свою очередь, регулирует выражение одного или нескольких генов, участвующих в формировании яичек и способности к оплодотворению. Из-за механизма, определяющего пол у человека, и очень большого различия в размере X- и Y-хромосом (X несет от 2000 до 3000 генов, а на Y хромосоме расположено несколько дюжин генов) есть много признаков, гены которых расположены только на X хромосоме. Они не имеют соответствующих аналогов на Y -хромосоме. Есть несколько белков, гены которых расположены только на -хромосоме и не имеют аналогов на X хромосоме, но такие гены редки. Признаки, сцепленные с полом, могут быть как доминантными, так и рецессивными. Сцепленные с полом признаки, кодируемые рецессивными генами на X хромосоме, обычно имеют три характеристики, которые сильно отличаются от характеристик признаков, кодируемых генами на а у т о с о м а х (неполовых хромосомах). 1 Обычно они чаще встречаются у самцов, чем у самок. 2. Они не появляются у самок, если отсутствовали у родителя по отцовской линии. 3. Они редко встречаются у отца и сына, и только в том случае, если мать гетерозиготна. Возможно, самый известный пример такого сцепленного с полом признака - гемофилия, болезнь, при которой нарушается нормальное свертывание крови (другие примеры приведены в табл. 14.1). Хромосома X несет рецессивные гены, контролирующие продукцию двух факторов свертывания крови, называемых факторами VIII и IX Если девочка наследует Х-хромосому с отсутствием таких генов, или они повреждены, то у нее остаются нормальные копии генов на другой X-хромосоме, и гемофилии у нее не будет. [стр. 170 ⇒]

Вопрос 28. Нерасхождение хромосом и его последствия (у человека и дрозофилы). К Бриджес. в 1916 г При скрещивании белоглазых самок с красноглазыми самцами наблюдается крисс-кросс-наследование все дочери оказываются похожими на отца — (красноглазые), а все сыновья — на мать (белоглазые) Однако очень редко, примерно 1—2 на две тысячи мух, появляются исключительные потомки красноглазые самцы и белоглазые самки Бриджес предположил, что такое отклонение от закономерностей наследования сцепленного с полом признака white можно объяснить редким явлением нерасхождения хромосом в мейозе у самок Нерасхождение хромосом у нормальных диплоидных самок называется первичным нерасхождением. Если по каким-либо причинам Х-хромосомы самки не расходятся в анафазе I к разным полюсам, а попадают к одному полюсу, может образоваться яйцеклетка с двумя Х-хромосомами (причем каждая несет аллель белых глаз) или яйцеклетка без Х-хромосом. Белоглазые самки появляются при оплодотворении яйцеклетки с двумя Х-хромосомами, полученными от матери, сперматозоидом с Y-хромосомой Следовательно, они должны иметь набор половых хромосом ХХУ Красноглазые самцы являются результатом оплодотворения яйцеклетки без X-хромосом сперматозоидом, несущим Х-хромосому отца и, следовательно, имеют набор половых хромосом ХО Изучив кариотипы «исключительных» мух, Бриджес полностью подтвердил свою гипотезу «Исключительные» самки имели две Х-хромосомы и одну Yхромосому, «исключительные» самцы — всего одну Х-хромосому.Таким образом, было показано, что нарушение закономерностей наследования признака, сцепленного с полом, связано с нарушением поведения половых хромосом в мейозе. Это однозначно свидетельствовало о том, что ген white расположен в Х-хромосоме. Нерасхождение Х-хромосом у самок XXY называют вторичным нерасхождением. При скрещивании белоглазых самок XXY с нормальными красноглазыми самцами XY в потомстве появляется около 4% исключительных мух: белоглазых самок и красноглазых самцов. Остальные потомки (их называют регулярными) — это красноглазые самки и белоглазые самцы. Во время мейоза у самок XXY возможны два типа конъюгации и расхождения хромосом. В результате могут образоваться яйцеклетки, содержащие только одну Х-хромосому, и яйцеклетки, содержащие две половые хромосомы: X и Y. При оплодотворении этих яйцеклеток сперматозоидами с Х-хромосомой должны появиться красноглазые самки двух типов: половина самок с набором XX и половина - с набором XXY. Цитологический анализ подтвердил это. При оплодотворении яйцеклеток сперматозоидом, несущим Y-хромосому, должны появиться белоглазые самцы, причем половина из них должна иметь набор XY, а половина — XYY. Цитологический анализ подтвердил и это. Если в яйцеклетку попадают две Х-хромосомы самки, то при оплодотворении такой яйцеклетки сперматозоидом с Y-хромосомой в потомстве должны обнаруживаться «исключительные» белоглазые самки с набором хромосом XXY.При оплодотворении яйцеклетки, в которую попала только Y-хромосома самки, сперматозоидом, несущим Х-хромосому, должны появиться красноглазые самцы XY. Цитологический анализ показал, что «исключительные» мухи и в этом случае — результат нерасхождения половых хромосом у самок XXY. В 1922 г. Лилиан Морган обнаружила самок дрозофилы, у которых частота нерасхождения Х-хромосом составляла 100%, т.е. у них обе Ххромосомы всегда отходили к одному полюсу деления, и, следовательно, формировались яйцеклетки двух типов: содержащие обе Ххромосомы и не содержащие Х-хромосом. Эти самки кроме того были гомозиготны по гену yellow (у), обусловливающему желтую окраску тела и щетинок. При скрещивании таких самок с самцами, имеющими нормальную окраску тела и щетинок, дочери всегда были похожи на мать, а сыновья всегда были похожи на отца. Цитологический анализ показал физическое сцепление Х-хромосом у таких самок. В их наборе хромосом обнаруживалась одна большая метацентрическая хромосома, состоящая из двух Х-хромосом, и одна Y-хромосома. Случаи нерасхождения половых хромосом у человека: • XXX (женщины без фенотипических особенностей, у 75% наблюдается умственная отсталость различной степени. Нередко недостаточное развитие фолликулов в яичниках, преждевременное бесплодие и ранний климакс. Носительницы ХХХ плодовиты, хотя риск спонтанных абортов и хромосомных нарушений у потомства у них несколько повышен по сравнению со средними показателями; частота проявления 1:700) • XXYY,XXXY,XXXXXY,XXY, Синдром Клайнфельтера (мужчины, обладающие некоторыми вторичными женскими половыми признаками; бесплодны; яички развиты слабо, волос на лице мало, иногда развиваются молочные железы; обычно низкий уровень умственного развития) • XYY (мужчины высокого роста с различным уровнем умственного развития)... [стр. 2 ⇒]

7. НАСЛЕДОВАНИЕ, СЦЕПЛЕННОЕ С ХРОМОСОМОЙ Y Хромосома Y содержит относительно небольшое число генов. К началу 2002 г. в ней картировано немногим более 35 генов, из них только 7 вызывают наследственные болезни, в том числе пигментный ретинит, несколько форм азооспермии, дисхондростеоз и гонадобластому, нарушение дифференцировки пола и др. В- хромосоме Y находится несколько генов «домашнего хозяйства», гомологичные им гены расположены в хромосоме X. Последние гены не инактивируются при инактивации хромосомы X. Как следует из табл. 5.5, хромосома У передается только от отца к сыну, и такое наследование называют голандрическим. Убедительно доказать, что признак наследуется сцепленно с хромосомой Y по родословным крайне трудно, так его надо дифференцировать от аутосомно-доминантного наследования. Только большие семьи, в которых среди сибсов встречаются и девочки, и мальчики, но признак такой же, как у отца, есть только у мальчиков, позволяют заподозрить, что речь идет об У-сцепленном наследовании. 83... [стр. 84 ⇒]

Размеры и форма этих хромосом неодинаковы, однако стандартные методы окрашивания не позволяют их идентифицировать. В группу D (№№ 13-15) объединены три пары акроцентрических хромосом среднего размера, морфологически сходных между собой. Все хромосомы группы D содержат спутник, который не всегда выявляется, может быть очень большим, а иногда и двойным. Длина короткого плеча этих хромосом также изменчива. К группе Е ( № № 16-18) относятся три пары почти метацентрических хромосом, из которых в 16-й паре центромера наиболее близка к середине, а две другие пары неотличимы друг от друга. Группа F содержит мелкие метацентрические аутосомы ( № № 1920), группа G — мелкие акроцентрические (№№ 21-22). Внутри групп F и G нары хромосом неразличимы. Длина коротких плечей у них изменчива, как и у хромосом группы D. Короткие плечи хромосом групп D и G содержат районы ядрышкового организатора. Перечисленные 22 пары хромосом относятся к аутосомам, одинаковым у мужчин и женщин. Половые хромосомы составляют 23-ю пару. У женщин — это две Х-хромосомы. У мужчин — Х- и Y-хромосомы. Половая Х-хромосома неотличима от аутосом группы С. При стандартном окрашивании она включается в состав этой группы: № № 6-12 и X. Мужская половая Y-хромосома является акроцептрической, сходна по морфологии с хромосомами группы G, но ее легко отличить по морфологическим критериям. Длина короткого плеча Y-хромосомы изменчива и индивидуальна, причем варианты длины плеча наследуются от отца к сыну. Y-хромосома, в отличие от хромосом последней группы, не имеет спутников. В ин... [стр. 58 ⇒]

Из двух половых хромосом только X-хромосома (но никак не Y-хромосома) определяет, какого окраса будет кот. Или если выразиться точнее, то только по состоянию гена О(о) на X-хромосоме мы можем сказать, какой цвет будет исходным в окрасе данного кота: красный или черный. На первый взгляд может показаться, что Y-хромосома лишена какой-либо информации об окрасе, но это ни в коем случае не соответствует действительности. Y-хромосома содержит множество дополнительной информации относительно окраса животного. Локус на X-хромосоме, управляющий окрасом шерсти, нам скажет только о том, какой исходный окрас (красный или черный) будет дополнен, обогащен или видоизменен под влиянием других генов. И вот эти-то "другие" гены могут быть расположены как на Xхромосоме, так и на Y-хромосоме. Разрешите предложить вашему вниманию две таблицы, в которых приведены доминантные и рецессивные гены. [стр. 8 ⇒]

Синдром Шерешевского—Тернера среди новорожденных девочек встречается с частотой 1:5000. При моносомии Ххромосомы развивается типичная форма дисгенезии гонад. Примерно у половины пациентов с синдромом Шерешевского—Тернера обнаруживается хромосомный мозаицизм (45, Х/46, XX) в результате нерасхождения Х-хромосом на ранних стадиях развития эмбриона. В зависимости от соотношения клонов ХХ/Х фенотип больных может проявляться от типичной картины заболевания до нормального фенотипа. Причиной синдрома Шерешевского—Тернера могут быть структурные нарушения одной из Х-хромосом, которая имеет вид кольцевой хромосомы, изохромосомы, делеции короткого плеча Х-хромосомы или др. У части больных с синдромом Шерешевского—Тернера обнаруживается в кариотипе присутствие Y-хромосомы или кольцевые и маркерные ее фрагменты. Г.Р.Осиповой (1997) было показано, что у 15,4% больных с синдромом Шерешевского—Тернера (кариотип 45, X) в лимфоцитах крови был обнаружен ген SRY, который свидетельствовал о наличии тканевого мозаицизма и присутствии Y-хромосомы. Идентификация этих хромосомных фрагментов имеет принципиальное значение, так как известно, что наличие Y-хромосомы в кариотипе пациенток с синдромом Шерешевского— Тернера часто сопровождается малигнизацией дисгенетичных гонад и требует высокой онкологической настороженности. Опухоли дисгенетичных гонад у таких пациентов до 16 лет выявляются в 10,2% случаев; во второй и третьей декадах жизни процент этот возрастает до 3035% (Розовский И.С. и др., 1977). Учитывая эти обстоятельства, идентификация Y-хромосомы и ее хромосомных фрагментов чрезвычайно важна, однако это не всегда возможно при использовании классического цитогенетического метода. В этом случае применяют молекулярно-цитогенетический FISH-метод, с помощью которого можно идентифицировать хромосомы и определять их количество. Преимущество этого метода заключается в том, что он позволяет не только на метафазных, но и на интерфазных клетках проводить исследование. Кроме того, с помощью этого метода можно проанализировать большое количество клеток, что ограничено при классическом цитогенетическом анализе. Это имеет принципиальное значение при установлении небольшого процента клона клеток с хромосомными нарушениями. [стр. 237 ⇒]

АНОМАЛИИ, ВЫЗВАННЫЕ ПОЛОВЫМИ ХРОМОСОМАМИ Обычно клетки человеческого тела содержат 46 хромосом, две из которых — хромосомы X и Y — играют основную роль в формировании пола. Точнее говоря, у мужчин одна хромосома X и одна хромосома Y, поэтому их обозначают XY; женщины же имеют две хромосомы X, обозначаемые XX. Отмечая существенность значения половых различий в агрессивном поведении, некоторые исследователи предположили, что эти различия могут быть связаны с особенностями хромосомных наборов мужчин и женщин (Jarvik, Klodin & Matsuyama, 1973; Meyer-Bahlburg, 1981b). Если бы ученым удалось найти достоверные подтверждения существования связи между хромосомным набором и склонности к агрессии, тогда нам стала бы вполне понятна природа различий в проявлениях агрессивности. Существуют два варианта гипотезы о влиянии хромосом на половые различия в агрессивном поведении: 1) гипотеза лишней Y -хромосомы утверждает, что наличие «лишней» Y-хромосомы у мужчин может привести к более выраженному проявлению агрессивности в поведении; 2) гипотеза лишней Х-хромосомы настаивает на том, что наличие «лишней» Х-хромосомы у женщин приводит к сравнительно менее выраженному проявлению той же агрессивности. Как заявляет Мейер-Бальбург (Meyer-Bahlburg, 1981b), «чем больше в генотипе Х-материала, тем слабее развивается агрессия, чем больше Y-материала, тем сильнее проявляется агрессия». [стр. 231 ⇒]

Во-вторых, большинство преступлений с применением насилия совершены людьми с нормальным набором хромосом — XY. Таким образом, наличие лишней Y-хромосомы отнюдь не является необходимым условием для совершения насильственных действий. В-третьих, более внимательное изучение заключенных с хромосомным набором XYY показало, что большинство из них были арестованы не за преступления с применением насилия, а за менее тяжкие преступления, такие как воровство или кража со взломом (Price & Whatmore, 1967). Наконец, Бандура (Bandura, 1973) заметил, что большая, по сравнению с лицами XY, склонность лиц XYY к насилию скорее всего имеет социальную, а не физическую основу. Например, будучи физически более развитыми по сравнению со своими ровесниками, такие лица могут подружиться с людьми старшего возраста и таким образом на ранней стадии своего развития подпасть под влияние преступных, склонных к насилию, типов. Кроме того, имея высокий рост, они зачастую получают преимущество при своих агрессивных выпадах против окружающих и поэтому быстро усваивают агрессивную манеру поведения. Уиткин с коллегами (W itkin & others, 1976) для выяснения роли лишней Yхромосомы в формировании агрессивного поведения исследовали всех мужчин, родившихся в Копенгагене с 1944 по 1948 год. Поскольку предшествующие работы показали, что лица с хромосомным набором XYY имеют рост выше среднего, Уиткин и коллеги сконцентрировали вниманце на самых рослых представителях этой группы, составивших 16% всех отобранных мужчин. Затем исследовательская группа попыталась выяснить хромосомный тип каждого из этих 4591 человека. В результате удалось исследовать 91% (4139 человек) всех этих лиц, из которых, как выяснилось, 12 человек имели хромосомный набор XYY, 4111 — XY и 16 — XXY. Кроме того, из достаточно большого количества судебных протоколов были получены сведения о росте, умственных способностях, социально-экономическом статусе преступников, а также о характере совершенных ими в прошлом преступлений. Это исследование показало, что только 9,3% лиц с хромосомным набором XY ранее уже совершили одно или несколько преступлений, в то время как среди лиц с XYY-хромосомами число их достигало 41,7%. В другом исследовании, посвященном изучению поведения лиц с аномальными Y-хромосомами, имеющими удлиненное плечо, была подвергнута проверке гипотеза о преимущественном влиянии на формирование агрессивного поведения Yхромосомы. Если эта гипотеза верна, следовало ожидать выраженных проявлений агрессии у лиц с лишним Y-материалом. Полученные данные, однако, оказались противоречивыми. В то время как в одних работах делается вывод о том, что Yхромосомы у преступников длиннее, чем у обычных людей, в других отмечается отсутствие достоверных подтверждений данной ranoTe3bi(Meyer-Bahlburg,1981b). Имеются данные о существовании зависимости уровня агрессии от длины Y-xpoмосом. Например, при наличии дополнительного Y-материала наблюдается более высокий уровень агрессии. Признавая, что подобные данные нельзя считать окончательными, Мейер-Бальбург (Meyer-Bahlburg, 1981b) предположил, что влияние аномальной Y-хромосомы, имеющей удлиненное плечо, аналогично влиянию лишней Y-хромосомы. Было предложено несколько вариантов объяснения зависимости высокого уровня преступности от наличия дополнительного Y-материала. Наиболее инте... [стр. 232 ⇒]

Исследователи высказали предположение, что эти люди обладали аномальным двойным набором генов Х-хромосомы, определяющих развитие женских черт, и с помощью этой двойной дозы было преодолено влияние SRY-гена Y-хромосомы, который в обычном случае доминирует над генами Х-хромосомы, что приводит к формированию мужских признаков. Это означает, что такое «обращение пола» чувствительно к дозе, т. е. кратному числу генов, определяющих развитие по женскому типу (Bardoni et al., 1994). Новооткрытый ген сначала получил обозначение DSS, так как он ответствен за «обращение пола, чувствительное к дозе» (dosage-sensitive sex reversal), но последние исследования показали, что ген с подобными свойствами, определяющими пол, расположен в области Х-хромосомы, уже обозначенной DAX-1 (Marx, 1995; Schafer, 1995). Существует по меньшей мере еще один ген, который, по всей видимости, тоже критически важен для определения пола, и не исключено, что свою роль в этом играют и другие гены (Ryner & Swain, 1995). Реальные механизмы, с помощью которых эти гены могут влиять на формирование мужских или женских признаков, все еще не поняты до конца. Иногда оплодотворенная яйцеклетка содержит только непарную Х-хромосому, или же вторая Х-хромосома как-либо повреждена. Это приводит к развитию по женскому типу, но яичники не могут нормально развиться и взрослая женщина не способна иметь детей (синдром Тернера). Оплодотворенная яйцеклетка с непарной Y-хромосомой и без Х-хромосомы, очевидно, нежизнеспособна. До сих пор не было обнаружено ни одного человека с одной непарной Y-хромосомой. Другие неправильные комбинации половых хромосом у человека — XXX (триплодия Х-хромосомы), XXY (синдром Кляйнфелтера) и XYY (синдром избыточной Y-хромосомы). В некоторых случаях может иметься нормальная пара половых хромосом, но с генетическими дефектами на одной из них. Дети, рожденные с подобными генетическими нарушениями, обычно отличаются неправильным развитием половых органов, необычной формой тела, нарушениями в поведении или задержкой умственного и эмоционального развития, что указано в табл. 4.1. [стр. 88 ⇒]

НОРМАЛЬНАЯ ПОЛОВАЯ ДИФФЕРЕНЦИРОВКА Генетический пол В норме соматические клетки человека содержат 22 пары аутосом и одну пару половых хромосом — XX или XY. Кариотип — это совокупность морфологических характеристик полного набора хромосом. Дифференциальное окрашивание позволяет по характерному набору полос идентифицировать каждую хромосому (рис. 44.1). При Q-окрашивании используют флюоресцентный краситель акрихин, при G-окрашивании — краситель Гимзы. С-окрашивание применяют для идентификации центромерных районов хромосом. Эти методы позволяют без труда выявить Y-хромосому по яркой флюоресценции как в метафазных, так и в интерфазных ядрах (рис. 44.2). Новый метод — флюоресцентная гибридизация in situ — особенно полезен для выявления так называемых маркерных хромосом, особенно половых хромосом с делениями, которые трудно обнаружить при стандартном окрашивании. В табл. 44.1 приведена номенклатура хромосом человека и их некоторых аномалий. Недавно был полностью картирован эухроматический район Y-хромосомы, образованный примерно 35 млн нуклеотидов. Как показали экспериментальные исследования и обследование больных с нарушениями половой дифференцировки, половые хромосомы и аутосомы несут гены, определяющие направление половой дифференцировки, то есть развитие из индифферентной половой железы яичка или яичника. Для развития яичников необходимы две нормальные Х-хромосомы и отсутствие Y-хромосомы (а также генов, определяющих развитие яичка). Для формирования яичек нужны Y-хромосома или район короткого плеча Y-хромосомы, кодирующий фактор развития яичка. У человека Х- и Y-хромосомы значительно отличаются по размеру. Компенсация дозы генов при наличии двр и более Х-хромосом достигается частичной инактивацией всех Х-хромосом, кроме одной. Этот случай... [стр. 242 ⇒]

Глава 44. Нарушения половой дифференцировки ло, больные имеют мужской фенотип, идентифицируют себя с мужским полом и имеют мужское полоролевое поведение. Строение яичек такое же, как при кариотипе 47,XXY. По крайней мере в 10% случаев встречаются гипоспадия или наружные половые органы промежуточного типа. Мужчины с кариотипом 46,ХХ имеют пропорциональное телосложение, взрослые ниже ростом, чем мужчины 47,ХХУили 46,XY, но выше женщин. Как иубольных с кариотипом 47,XXY, уровень тестостерона в сыворотке снижен или находится на нижней границе нормы, уровни гонадотропных гормонов повышены. У взрослых нарушен сперматогенез. Гинекомастия встречается примерно у трети больных. Ответ на вопрос, почему у лиц с кариотипом 46,XX формируются яички и мужской фенотип, дали исследование сцепления генов и анализ полиморфизма длин рестрикционных фрагментов Х-хромосомы. Как оказалось, мужчины 46,XX наследуют по одной Х-хромосоме от каждого из родителей. Примерно у 80% больных выявлена транслокация дистального участка короткого плеча Y-хромосомы на дистальный участок короткого плеча отцовской Х-хромосомы. Длина транслоцированного участка непостоянна, но он всегда включает ген SR Y, кодирующий фактор развития яичка, и псевдоаутосомный район Y-хромосомы. Таким образом, 80% случаев мужского фенотипа при кариотипе 46,ХХ объясняются аномальным обменом участков Х- и Y-хромосом в процессе мейоза у отца, при этом образуются две хромосомы: Х-хромосома, несущая ген SRY, и Y-хромосома, лишенная этого гена (если рождается ребенок с женским фенотипом, то обязательно с дисгенезией гонад 46,XY). У остальных больных последовательности нуклеотидов, включающей ген SRY, а также псевдоаутосомного района Y-хромосомы в кариотипе нет. При этом повышен риск гипоспадии, а в семейном анамнезе могут быть указания на истинный гермафродитизм. Формирование мужского фенотипа и развитие яичек при кариотипе 46,XX в отсутствие генов Y-хромосомы предполагает, что для половой дифференцировки по мужскому типу наличие этих генов необязательно. Она может объясняться: 1) мутацией аутосомного гена, участвующего в половой дифференцировке по мужскому типу, 2) мутацией, делецией или аномальной инактивацией генов Х-хромосомы, влияющих на развитие яичек, 3) ограниченным мозаицизмом, когда Y-хромосому содержат лишь отдельные клеточные линии, например половых желез. Чтобы выяснить механизм половой дифференцировки по мужскому типу у лиц с кариотипом 46,XX в отсутствие транслокации генетического материала с Y-на Х-хромосому, нужны дальнейшие исследования. [стр. 254 ⇒]

Цитогенетика Предмет цитогенетики — исследование нормального хромосомного набора и хромосомных аномалий, лежащих в основе наследственных болезней. I. Хромосомные аномалии. Нормальный хромосомный набор человека включает 46 хромосом, в том числе 22 пары аутосом и 1 пару половых хромосом XX или XY. Частота хромосомных аномалий у детей, родившихся живыми, составляет 0,7%; у мертворожденных плодов — 5%; при ранних самопроизвольных абортах — 50%. Известно множество хромосомных аномалий, в том числе — связанных с эндокринными болезнями (см. табл. 4.1). Основные типы аномалий: А. Численные изменения хромосомного набора. Б. Структурные изменения (аберрации) отдельных хромосом. Аномалии могут затрагивать как аутосомы, так и половые хромосомы. Если хромосомная аномалия присутствует в половой клетке, то все клетки будущего организма наследуют эту аномалию (что приводит к развитию полной формы наследственной болезни). Хромосомные аномалии могут возникать и в соматических клетках, особенно на ранних стадиях эмбриогенеза. В таких случаях только часть клеток организма имеет хромосомную аномалию (хромосомный мозаицизм). Часто встречается мозаицизм по половым хромосомам. Для унификации цитогенетических исследований разработана Международная цитогенетическая номенклатура хромосом человека (ISCN, 1978), основанная на дифференциальном окрашивании хромосом по длине. Эта номенклатура позволяет подробно описать каждую хромосому: ее порядковый номер, плечо (p — короткое плечо, q — длинное плечо), район, полосу и даже субполосу. Например, 2p12 обозначает 2ю хромосому, короткое плечо, район 1, полосу 2. II. Дифференциальное окрашивание хромосом. Разработан ряд методов окрашивания (бэндинга), позволяющих выявить комплекс поперечных меток (полос, бэндов) на хромосоме. Каждая хромосома характеризуется специфическим комплексом полос. Гомологичные хромосомы окрашиваются идентично, за исключением полиморфных районов, где локализуются разные аллельные варианты генов. Аллельный полиморфизм характерен для многих генов и встречается в большинстве популяций. Выявление полиморфизмов на цитогенетическом уровне не имеет диагностического значения. А. Q-окрашивание. Первый метод дифференциального окрашивания хромосом был разработан шведским цитологом Касперссоном, использовавшим с этой целью флюоресцентный краситель акрихин-иприт. Под люминесцентным микроскопом на хромосомах видны участки с неодинаковой интенсивностью флюоресценции — Qсегменты. Метод лучше всего подходит для исследования Y-хромосом и потому используется для быстрого определения генетического пола, выявления транслокаций (обменов участками) между X- и Y-хромосомами или между Y-хромосомой и аутосомами, а также для просмотра большого числа клеток, когда необходимо выяснить, имеется ли у больного с мозаицизмом по половым хромосомам клон клеток, несущих Y-хромосому. Б. G-окрашивание. После интенсивной предварительной обработки, часто с применением трипсина, хромосомы окрашивают красителем Гимзы. Под световым 37... [стр. 37 ⇒]

В предварительной диагностике болезней, обусловленных аномалиями половых хромосом, основное значение имеет анамнез: задержка полового развития, нарушение формирования вторичных половых признаков, бесплодие, самопроизвольные аборты. Экспресс-методы цитогенетического анализа (например, определение полового хроматина в соскобе со слизистой щек) не всегда дают надежные результаты. Поэтому при подозрении на аномалию половых хромосом требуется детальное цитогенетическое исследование большого числа клеток. Одна из основных задач такого исследования — исключение мозаицизма при дисгенезии гонад. Наличие у больного с мозаицизмом клона клеток, несущих Y-хромосому, свидетельствует о повышенном риске гонадобластомы. В тех случаях, когда вероятность аномалии половых хромосом высока, но в лимфоцитах аномалия не обнаружена, нужно исследовать клетки других тканей (обычно фибробласты кожи). 1. Синдром Тернера — это клиническое проявление аномалии одной из X-хромосом у женщин. Синдром Тернера в 60% случаев обусловлен моносомией X-хромосомы (кариотип 45,X), в 20% случаев — мозаицизмом (например, 45,X/46,XX) и в 20% случаев — аберрацией одной из X-хромосом (например, 46,X[delXp–]). Распространенность синдрома Тернера, обусловленного полной моносомией Xхромосомы (45,X), среди детей, родившихся живыми, составляет 1:5000 (у девочек 1:2500). Плоды с кариотипом 45,X спонтанно абортируются в 98% случаев. Синдром характеризуется множественными пороками развития скелета и внутренних органов. Важнейшие фенотипические признаки: низкорослость и дисгенезия или полное отсутствие гонад (на месте яичников находят недифференцированные соединительнотканные тяжи, не содержащие половых клеток и фолликулов). Другие признаки: короткая шея с крыловидными кожными складками, низкая линия роста волос на затылке, бочкообразная грудная клетка, нарушение пропорций лица, Ообразное искривление рук (деформация локтевых суставов), X-образное искривление ног. а. Цитогенетические варианты синдрома. У больных с кариотипом 45,X обычно отсутствует отцовская X-хромосома; возраст матери не является фактором риска. Кариотип 45,X в большей части случаев обусловлен нерасхождением половых хромосом в 1-м делении мейоза (в результате в зиготу попадает только одна X-хромосома), реже — нарушениями митоза на ранних стадиях дробления зиготы. У больных с мозаицизмом встречаются клоны клеток, содержащих две Xхромосомы (45,X/46,XX), X- и Y-хромосомы (45,X/46,XY) либо клоны с полисомией X-хромосомы (например, 45,X/47,XXX). Иногда наблюдаются транслокации между X-хромосомой и аутосомами. Транслокации и наличие дополнительных клеточных линий у больных с мозаицизмом сильно влияют на формирование фенотипа. Если имеется клон клеток, несущих Y-хромосому, то в зачатках половых желез с одной или с обеих сторон может присутствовать гормонально-активная ткань яичек; наблюдаются наружные половые органы промежуточного типа (от гипертрофированного клитора до почти нормального полового члена). Возможные аберрации X-хромосомы при синдроме Тернера: изохромосома по длинному плечу [i(Xq)], в редких случаях изохромосома по короткому плечу [i(Xp)]; концевая делеция длинного плеча [del(Xq–)] или делеция всего длинного плеча (Xq–), концевая делеция короткого плеча [del(Xp)] или делеция всего короткого плеча (Хр–); концевая перестройка X-хромосомы [46,X,ter rea(X;X)]; кольцевая X-хромосома [46X,r(X)]. Если аберрантная X-хромосома инактивируется, аберрация может вообще не проявляться в фенотипе или проявляется не полностью. В последнем случае аберрация частично 41... [стр. 41 ⇒]

Предмет цитогенетики — исследование нормального хромосомного набора и хромосомных аномалий, лежащих в основе наследственных болезней. I. Хромосомные аномалии. Нормальный хромосомный набор человека включает 46 хромосом, в том числе 22 пары аутосом и 1 пару половых хромосом XX или XY. Частота хромосомных аномалий у детей, родившихся живыми, составляет 0,7%; у мертворожденных плодов — 5%; при ранних самопроизвольных абортах — 50%. Известно множество хромосомных аномалий, в том числе — связанных с эндокринными болезнями (см. табл. 4.1). Основные типы аномалий: А. Численные изменения хромосомного набора. Б. Структурные изменения (аберрации) отдельных хромосом. Аномалии могут затрагивать как аутосомы, так и половые хромосомы. Если хромосомная аномалия присутствует в половой клетке, то все клетки будущего организма наследуют эту аномалию (что приводит к развитию полной формы наследственной болезни). Хромосомные аномалии могут возникать и в соматических клетках, особенно на ранних стадиях эмбриогенеза. В таких случаях только часть клеток организма имеет хромосомную аномалию (хромосомный мозаицизм). Часто встречается мозаицизм по половым хромосомам. Для унификации цитогенетических исследований разработана Международная цитогенетическая номенклатура хромосом человека (ISCN, 1978), основанная на дифференциальном окрашивании хромосом по длине. Эта номенклатура позволяет подробно описать каждую хромосому: ее порядковый номер, плечо (p — короткое плечо, q — длинное плечо), район, полосу и даже субполосу. Например, 2p12 обозначает 2ю хромосому, короткое плечо, район 1, полосу 2. II. Дифференциальное окрашивание хромосом. Разработан ряд методов окрашивания (бэндинга), позволяющих выявить комплекс поперечных меток (полос, бэндов) на хромосоме. Каждая хромосома характеризуется специфическим комплексом полос. Гомологичные хромосомы окрашиваются идентично, за исключением полиморфных районов, где локализуются разные аллельные варианты генов. Аллельный полиморфизм характерен для многих генов и встречается в большинстве популяций. Выявление полиморфизмов на цитогенетическом уровне не имеет диагностического значения. А. Q-окрашивание. Первый метод дифференциального окрашивания хромосом был разработан шведским цитологом Касперссоном, использовавшим с этой целью флюоресцентный краситель акрихин-иприт. Под люминесцентным микроскопом на хромосомах видны участки с неодинаковой интенсивностью флюоресценции — Qсегменты. Метод лучше всего подходит для исследования Y-хромосом и потому используется для быстрого определения генетического пола, выявления транслокаций (обменов участками) между X- и Y-хромосомами или между Y-хромосомой и аутосомами, а также для просмотра большого числа клеток, когда необходимо выяснить, имеется ли у больного с мозаицизмом по половым хромосомам клон клеток, несущих Y-хромосому. Б. G-окрашивание. После интенсивной предварительной обработки, часто с применением трипсина, хромосомы окрашивают красителем Гимзы. Под световым 38... [стр. 39 ⇒]

...гл. 331). К возрасту ожидаемого полового созревания эти тяжи уже не содержат различимых фолликулов и яйцеклеток; в них присутствует фиброзная ткань, неотличимая от нормальной стромы яичников. Сопутствующие соматические аномалии затрагивают в основном скелет и соединительную ткань. В младенческом возрасте болезнь диагностируют по наличию лимфатического отека кистей и стоп, складчатости шеи, низкой линии оволосения, избыточных кожных складок на затылке, щитообразной грудной клетке с широко расставленными сосками и малой массе тела при рождении. Кроме того, у больных характерное лицо с маленькой челюстью, эпикантус, низко расположенные или деформированные уши, рыбий рот и птоз. В 50% случаев отмечают укорочение IV пястных костей, а в 10—20%— коарктацию аорты. Рост у взрослых больных редко превышает 150 см. Сопутствующие нарушения включают пороки развития почек, пигментированные родимые пятна, гипоплазию когтей, склонность к кетозу, потерю слуха, необъяснимую гипертензию и аутоиммунные нарушения. Около 20% больных страдают гипотиреозом. Патофизиология. Примерно у 50% больных обнаруживают карпотип 45, X, у 25% — мозаицизм без структурных нарушений (46, ХХ/45, X), а у остальных — структурные нарушения Х-хромосомы с мозаицизмом или без него (см. гл. 60). Вариант 45, X обусловлен потерей хромосомы в процессе гаметогенеза у любого из родителей или с ошибкой митоза при одном из ранних делений оплодотворенной зиготы (см. рис. 332-2). Низкорослость и другие соматические изменения являются следствием потери генетического материала с короткого плеча Х-хромосомы. Гонадальные тяжи образуются при потере генетического материала либо с длинного, либо с короткого плеча Х-хромосомы. У больных с мозаицизмом или структурными нарушениями Х-хромосомы изменения фенотипа занимают по тяжести промежуточное положение между теми, которые наблюдаются при варианте 45,Х, и нормой. У некоторых больных с гипертрофией клитора, помимо Х-хромосомы, присутствует фрагмент еще какой-то хромосомы, предположительно — аномальной Y-хромосомы. В редких случаях сбалансированная Х-аутосомная транслокация может обусловить семейную передачу дисгенезии гонад (см. гл. 60). Раньше для выявления нарушений Х-хромосом исследовали половой хроматин. Половой хроматин (тельца Барра) у здоровых женщин — продукт инактивации одной из двух Х-хромосом; женщин с хромосомным набором, 45,Х, подобно нормальным мужчинам, относили к группехроматинотрицательных. Однако хроматинотрнцательными являются лишь около 50% больных с дисгенезией гонад (больные с кариотнпом 45,Х и с наиболее выраженным мозаицизмом и структурными нарушениями). Поэтому для установления диагноза и идентификации больных с элементами Y-хромосомы и высоким риском возникновения злокачественных опухолей в гоиадальных тяжах необходим анализ кариотипа В период ожидаемого полового созревания оволосение подмышек и лобка скудное, молочные железы неразвиты, менструаций нет. Содержание ФСГ в сыворотке, повышенное в младенчестве, в детстве снижается до нормы, а в возрасте 9—10 лет возрастает до уровня, характерного для кастратов. В это время содержание Л Г в сыворотке также повышено, а уровень эстрадиола в плазме снижен (менее 10 пг/мл). Примерно у 2% больных с вариантом 45,X и у 12% больных с мозаицизмом в яичниках сохраняется достаточное число фолликулов, чтобы иногда возникали менструации. Больше того, у лице минимальными повреждениями иногда возможна беременность. Однако продолжительность детородного периода у таких больных невелика. Лечение. В ожидаемое время полового созревания следует начать заместительную терапию эстрогенами, чтобы индуцировать развитие молочных желез, половых губ, влагалища, матки и маточных труб (см. гл. 331). В первый год лечения эстрадиолом скорость роста тела в длину и созревания костей примерно удваивается, но окончательный рост больных редко достигает ожидаемого (см. гл. 331). Лечение гормоном росшие приносит успеха. У больных с вариантом 45. X опухоли гонад встречаются редко, но у некоторых лиц с мозаицизмом по Y-хромосоме они возникают. Поэтому гонадальные тяжи следует удалять в любом случае при наличии признаков вирилизации или при обнаружении линии клеток, содержащих Y-хромосому. [стр. 321 ⇒]

Т.о., было установлено, что факторы пола локализованы в специальных половых хромосомах. Обычно партнеры этой пары разной величины: более крупный содержит факторы женского пола и называется Ххромосомой, меньший называется Y-хромосомой. Факторы, определяющие мужской пол, могут быть локализованы в Y-хромосоме (у млекопитающих и человека) или в др. обычных хромосомах -аутосомах (например, у дрозофилы). У многих видов, где мужской пол определяется аутосомами, Y-хромосома отсутствует. Обычно у самки имеются 2 одинаковые хромосомы (тип XX), а у самца или 2 неодинаковые (XY, типично для человека), или одна мужская хромосома (тип Х0). Т.к. в клетках самки имеются две Х-хромосомы, то в результате мейоза яйцеклетка содержат по одной Ххромосоме (гомогаметный пол). У самцов же с XY-хромосомами образуются спермии двух типов: в одних Х-хромосома, в др. Y-хромосома (гетерогаметный пол). Случайное соединение половых клеток (гамет) в процессе оплодотворения приводит к появлению равного количества женщин (XX) и мужчин (XY). Кроме генов, определяющих пол, в половых хромосомах локализованы гены, определяющие различные признаки, которые называются сцепленными с полом, т.к. их наследование связано с наследованием пола. Примерами служат рецессивные гены гемофилии и альбинизма у человека. Эти гены проявляются у мужчин и не проявляются у женщин, если они содержатся только в одной из Х-хромосом женщины. Т.о., женщины являются скрытыми носителями болезней, сцепленных с полом. Отклонения от нормального числа половых хромосом в клетках человека приводят к нарушениям развития, среди которых известны синдромы Шерешевского-Тернера (Х0) у женщин (малый рост, бесплодие, умственная отсталость), синдром Клайнфелтера (XXY) у мужчин высокий рост, длинные конечности, нарушения развития признаков пола, бесплодие, умственная отсталость; число Х-хромосом при этом синдроме может достигать 4 (XXXXY); синдром трисомии Х-хромосом (XXX) у женщин, проявляющийся в нарушении психики и в недоразвитии яичников и др. 647. Полуобезьяны - группа примитивных приматов, которых обычно классифицируют как подотряд Prosimii или Strepsirhini отряда Primates. В разных систематических схемах к полуобезьянам относят лемуровых, индри, руконожек, лориевых а, иногда, долгопятов, и даже тупай. Т.о. систематика не вполне однозначна. Основные признаки, отличающие полуобезьян от высших приматов: ночной образ жизни, сравнительно простое поведение, часто - насекомоядность или плодоядность. 648. Понгиды (Pongidae) - семейство человекообразных высших обезьян, включающее современных: орангутана (Pongo pygmaeus), гориллу (Gorilla gorilla), шимпанзе (Pan troglodytes), бонобо или карликового шимпанзе (Pan paniscus). Орангутаны возникли от азиатских сивапитеков (Sivapithecus), происхождение африканских понгид неизвестно. В Юго-Восточной Азии существовали особые вымершие понгиды - гигантопитеки (Gigantopithecus), челюсти которых были в два раза больше, чем у современных горилл. Наиболее близки к человеку анатомически и поведенчески шимпанзе. В целом от человека понгиды отличаются четвероногостью (соответственно, длинными руками и короткими ногами), растительноядностью (соответственно, большими челюстями с большими зубами и особенно - клыками, мощным костным рельефом на черепе) и примитивным поведением (соответственно, более примитивным мозгом). Африканские понгиды столь близки к человеку, что в некоторых современных классификациях их относят к семейству гоминид, вместе с человеком. Тогда в семействе понгид из современных антропоидов остается только орангутан. Общий предок шимпанзе и человека жил около 4-8 миллиона лет назад. 649. Понтийский тип индо-средиземноморской расы, или понтийская раса, черноморский или восточносредиземноморский тип - распространен среди народов побережья Черного моря, например, адыгейцев и южных русских. Отличается от... [стр. 392 ⇒]

1 могильника Ак-Алаха-1, по материнской линии. Аллельный профиль STR-локусов Y-хромосомы. В рамках нашего исследования он был использован как один из маркеров половой принадлежности останков (см. выше), в качестве маркера родства индивидов по мужской линии, а также филогенетически и филогеографически информативного маркера, отражающего историю мужской части популяции пазырыкцев. Для индивида 1 нам удалось реконструировать полный профиль из 17 STR-локусов Y-хромосомы. Из-за относительно низкой степени сохранности ДНК в останках индивида 2 для него были получены данные только по 12 STR-локусам из 17 (табл. 2). Аллельные варианты для STR-локусов, успешно генотипированных в обоих случаях, полностью идентичны. Это с высокой вероятностью указывает на принадлежность данных индивидов к одной линии Y-хромосомы, что предполагает их близкое родство по мужской линии. Исследование структуры Y-хромосомы с целью проведения филогенетического и филогеографического анализа может быть осуществлено двумя способами. Один заключается в анализе ОНП Y-хромосомы, которые маркируют принадлежность к конкретным ее гаплогруппам и подгруппам; другой – генотипировании набора STR-локусов и определении филогенетической принадлежности с помощью специальных программ, выявляющих корреляцию между STR-профилями и филогенетическими кластерами Y-хромосомы. Нами был использован последний. Полученный полный аллельный профиль по 17 STRлокусам позволил определить принадлежность исследуемого варианта Y-хромосомы к гаплогруппе N (вероятность по данным программы Haplogroup Predictor составила 100 %). Эта гаплогруппа возникла в Юго-Восточной Азии, но впоследствии длительное время эволюционировала на территории Южной Сибири [Харьков, 2012]. Именно через Алтае-Саянское нагорье пролегал путь распространения ее подгрупп в другие регионы Евразии – преимущественно в северные широты от Восточной Европы до Дальнего Востока. Подгруппы гаплогруппы N имеют филогеографическую специфику, многие из них сформировались на юге Сибири, именно здесь наблюдается наибольшее разнообразие вариантов этой гаплогруппы. Для точного установления принадлежности исследуемого варианта Y-хромосомы к подгруппам гаплогруппы N требуется проведение дополнительного анализа его ОНП маркеров. Эта задача будет решена в рамках масштабного исследования разнообразия линий Y-хромосомы в генофонде пазырыкских по... [стр. 148 ⇒]

Вступление в доха даже групп, проживавших далеко друг от друга, указывает на процесс дробления больших локальных общностей на мелкие, их перемешивание и перемещение, вызванное миграцией тунгусов. В результате соседями могли оказаться кровнородственные группы, сблизившиеся через институт доха. Также предполагается, что созданное родовое объединение Самар могло базироваться на изначальном генетическом родстве его представителей [Туголуков, 1972]. В настоящей работе показано современное расселение рода Самар в Хабаровском крае, изучен его генофонд по SNP-маркерам Y-хромосомы, а также определена степень генетического родства с другими популяциями нанайцев и народами соседних территорий. Специфика геногеографических исследований В последние десятилетия изучение генетического разнообразия популяций человека стало одним из самых актуальных направлений науки. Это обусловлено появлением в арсенале популяционной генетики т.н. однородительских нерекомбинирующих маркеров, локализованных на митохондриальной ДНК и Y-хромосоме человека. Поскольку первые имеют материнский тип наследования, а вторые – отцовский, в совокупности они дают раздельное понятие о вкладе представителей разных полов в историю становления генофонда. В настоящее время в филогеографических исследованиях населения маркеры Y-хромосомы исследуются более интенсивно, чем мтДНК, потому что по Y-хромосоме выявляется большее генетическое разнообразие и обнаруживается четкая корреляция с географическим положением и этнической историей населения [Балановская, Балановский, 2007]. Поскольку данная работа основана на использовании маркеров Y-хромосомы, остановимся более подробно на особенностях ее генома и характеристике типов ее полиморфизма. Протяженно сть Y-хромо сомы со ст авляет ок. 60 млн пар нуклеотидов, ее концевые (теломерные) участки вступают в кроссинговер с гомологичными участками X-хромосомы. Все остальное пространство (более 50 млн пар нуклеотидов) занимает группа сцепленных генов, которая не разрушается рекомбинацией и передается из поколения в поколение в виде единого гаплотипа. Новые гаплотипы образуются только путем мутагенеза. Такой механизм возникновения изменчивости позволяет анализировать родство индивидов со сходными последовательностями нерекомбинирующей части Y-хромосомы, что невозможно для рекомбинирующих аутосомных маркеров. [стр. 147 ⇒]

При изучении разнообразия Y-хромосомы исследуют два типа генетического полиморфизма (соответственно два типа маркеров). Однонуклеотидные полиморфизмы (SNP – single nucleotide polymorphism) возникают в Y-хромосоме достаточно часто. Точечные мутации почти никогда не происходят в одной и той же позиции дважды. Исследование SNP позволяет отнести анализируемый образец к той или иной ветви родословного древа Y-хромосомы – гаплогруппе – или ее субветви. Таким образом, мутация является «меткой» для всех последующих потомков и позволяет надежно отличать один «род» от другого. Как правило, у обозначения гаплогруппы (например, N1c1) указывают наименование маркера (индекс), ее определяющего (например, для N1c1 индекс М172). Это связано с тем, что Y-хромосомное древо гаплогрупп постоянно совершенствуется и происходят изменения в их названии, однако маркеры конкретных мутаций не меняются. При втором типе полиморфизма различия между индивидами определяются по числу аллелей – коротких тандемных повторов (STR – short tandem repeats) в определенных локусах Y-хромосомы. В ряду поколений этот показатель сохраняется, т.е. у ребенка-мальчика, его отца, деда и т.д. будет одинаковый гаплотип Y-хромосомы. Однако все же происходят изменения числа аллелей – возникают новые мутации, причем гораздо чаще, чем SNP, примерно одна на 22 поколения (500 лет). Обратим внимание на то, что, не зная, к какой гаплогруппе принадлежит исследуемый образец, точно невозможно сказать, действительно ли данный индивид является родственником другого с похожим набором STR-маркеров. Чтобы это проверить, нужно проанализировать SNP-маркеры. Именно поэтому наиболее эффективно параллельное исследование обеих генетических систем (SNP и STR). Их образно сравнивают с часовой и минутной стрелкой: первая (SNP) показывает позицию образца на родословном древе в «глобальном» масштабе, а вторая (STR) – его более точное положение. Исследование STR на фоне данных об SNP позволяет датировать возникновение отдельных кластеров гаплотипов (т.е. ветвей родословного древа Y-хромосомы). Существуют два подхода к анализу SNP-маркеров Y-хромосомы. При первом (традиционном) анализируются отдельные, наиболее информативные маркеры. Второй подход (ставший технически возможным только в самые последние годы) заключается в полной расшифровке нуклеотидной последовательности Y-хромосомы, что позволяет выявить все SNP-маркеры Y-хромосомы, присутствующие у данного образца. В связи с высокой стоимостью полногеномного секвенирования этот подход в нашей работе реализован для одного образца (представителя гаплогруппы С3*-М130), а первый – для всех. [стр. 148 ⇒]

Кроме отсутствия рекомбинации и передачи по материнской линии, мтДНК обладает особенностями, делающими её ценным материалом для молекулярного исследования ископаемых останков. Так, в клетке присутствует 100-1000 копий мтДНК (по сравнению с единичными копиями ядерных генов), а кольцевая форма мтДНК делает её более устойчивой к разрушению, которое часто начинается со свободных концов линейной молекулы ядерной ДНК. Анализ двух образцов неандертальской мтДНК выявил общие отличия от мтДНК современного человека. Этот факт свидетельствует о том, что неандертальцы представляют отдельный, хотя и близкородственный человеку, вид. Время существования последнего общего предка человека и неандертальца оценивается по числу различий между мтДНК как 500 тыс. лет, что согласуется с палеонтологическими данными. Популяции предков Homo neanderthalensis и Homo sapiens разошлись 300 тыс. лет назад. Денисовский человек стал вторым после неандертальца видом вымерших гоминид, для которого расшифрован митохондриальный и ядерный геномы (2010 г.), и первым видом из рода людей, который был идентифицирован на основании молекулярных исследований. Его останки обнаружены в 2008 г. российскими археологами в Денисовой пещере на Алтае, где ещё 40 тыс. лет назад эту территорию населяли денисовцы, неандертальцы и современные люди. Образец стандартной мтДНК отличается от мтДНК денисовского человека по 385 нуклеотидам, а от мтДНК неандертальца — на 202 нуклеотида. Денисовский человек находится ближе к неандертальцу, хотя их эволюционное расхождение произошло около 640 тыс. лет назад. Y-хромосома Адама Y-хромосома в ядрах клеток мужского организма представлена единственной копией и содержит около 58 млн. п.н. Особенность Y-хромосомы заключается, в том, что она содержит два региона, один из которых имеет гомологичный участок с Х-хромосомой, расположенный на концах Y-хромосомы, занимающий около 5% её длины и способный к рекомбинации, а второй (95%) не имеет гомологичных участков и не рекомбинирует. Он содержит гены, функционирующие только в мужском организме, и передаётся из поколение в поколении в неизменном виде. Так, исследование Y-хромосомы 1000 мужчин из разных мест проживания на Земле выявило 116 гаплотипов, которые позволили составить эволюционное дерево, корни которого уходят в Африку. Самые древние варианты Y-хромосомы найдены у представителей африканского племени койсанов, что подтверждает гипотезу об африканском происхождении Адама. [стр. 17 ⇒]

ВИРТУАЛЬНАЯ ЛАБОРАТОРИЯ. МОЛЕКУЛЯРНАЯ ГЕНЕАЛОГИЯ Введение. Молекулярная генеалогия использует ДНК-маркёры и традиционные генеалогические методы исследования и позволяет получить информацию, которая передаётся неизменной от отца к сыну по прямой мужской линии через Y-хромосому, или от матери к детям обоего пола через мтДНК. Маркёры мтДНК и Y-хромосомы позволяют проследить генетическую историю человечества отдельно по женской и мужской линиям. ДНК-маркёры позволяют установить общего предка, а также установить или опровергнуть родственные связи между людьми. В качестве ДНК-маркеров используют микросателлиты STR-маркёры (от англ. Short Tandem Repeat — короткие тандемные повторы) (см. «Медицинская генетика», часть 3). Поскольку нуклеотидная последовательность в микросателлитах одинакова, а количество повторов может быть разным, то микросателлиты оказались удобным маркёром для обнаружения их в геноме и подсчёта количества повторов. Число повторов в одном и том же локусе хромосомы может варьировать, а совокупность STR-маркёров индивидуального генома образует его уникальный неповторимый гаплотип. Тестирование ДНК Y-хромосомы имеет особый интерес, т.к. локусы Y-хромосомы, наследуемые по мужской линии, не подвергается кроссинговеру с каждым новым поколением. При этом мутация в маркёрных локусах встречаются крайне редко, примерно одна мутация на 500 поколений, или за 10000 лет. В специализированных база данных, например, http://www.yhrd.org/, http://www.ysearch.org/ , https://www.smgf.org/, http://www.oxfordancestors.com/, http://ybase.org/, http:/ /dna.ancestry.com/, записаны образцы гаплотипов из разных стран и континентов. Базы позволяют по совпадениям гаплотипов с фамилиями людей строить генеалогическое древо, т.е. устанавливать родство и предполагаемого общего предка. Маркёры Y-хромосомы. DYS456 (DNA Y-chromosome Segment № 456) имеет последовательность: GGACCTTGTGATAATGTA/AGAT/ AGAT/AGAT/AGAТ/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ AGAT/AGAT/AGAT/ATTCCATTAGTTCTGTCCCTCTAGAGAA CCCTAAT ACATCAGTTTAAGAAGTTTTGGGCTGAGTTGATGGG Нетрудно заметить, что последовательность AGAT представлена 15 повторами. В маркере DYS456 число повторений может колебаться от 12 до 18 ([AGAT]12-[AGAT]18). Число повторов в маркёрах сына будет тем же самым, что и у его отца. Однако в результате мутации число повторов в одной мужской линии может увеличиваться или уменьшаться, отец может иметь DYS456 = 15, а его сын DYS456 = 16. Учитывая при... [стр. 30 ⇒]

Разнообразие, которое мы находим во всем мире, разделено на дискретные, хотя и связанные между собой, единицы, характеризующиеся маркерами — потомками древних мутаций. Отмечая эти маркеры на карте мира, можно проследить прошлые миграции в деталях. Отслеживая порядок, в каком появлялись мутации, датируя их появление и учитывая демографические данные (например, исчезновение или увеличение популяций), мы можем получить подробную информацию о том путешествии. И первое свидетельство исходит от одного человека, обладавшего весьма значительной мутацией Y-хромосомы, которая возникла 31 000–79 000 лет назад. Этой мутации дали довольно прозаичное имя M168. Более выразительно носителя этой мутации можно было бы назвать Евразийским Адамом — пра... пра-прадедом каждого из живущих сегодня мужчин-неафриканцев. Путешествие, предпринятое его сыновьями и внуками, определило дальнейший ход человеческой истории. Может показаться удивительным, что самые отчетливые свидетельства о маршруте, каким следовали из Африки наши предки, дает нам Y-хромосома. Действительно ли мужчины склонны «сеять свое семя», что приводит к широкому распространению региональных генетических сигналов? Как ни странно, нет. И быстрая потеря старых рецептов супа по мужской линии (пример, который мы использовали, чтобы объяснить более позднее появление Адама) означает, что мужчины, живущие в одном регионе, имеют недавнего общего предка, и дают нам отчетливые «отпечатки пальцев» в конкретных географических регионах. Это значит, что Y-хромосома ясно указывает на проделанное древними людьми путешествие. Это в буквальном смысле слова «путешествие мужчины», и Y-хромосома —лучший из имеющихся у нас инструментов, с помощью которого мы можем узнать детали этого путешествия. Но, безусловно, важно изучить и женскую линию человечества, чтобы увидеть, следовала ли она той же схеме —то есть убедиться, что рыба оставалась, так сказать, с велосипедом2. Однако именно Y-хромосома отражает историю расселения человечества по планете. Если мы посмотрим более внимательно на расположение ветвей на митохондриальном дереве, то обнаружим аналогичную картину — все неафриканские митохондриальные ветви сходятся к одной ветке, означая, что наш Адам M168 имел жену Еву. К счастью, эта евразийская Ева жила около 50 000–60 000 лет назад, а значит она и евразийский Адам могли встретиться. Она зовется (и в этот раз) довольно скучно L3, и ее дочери в компании сыновей M168 во время своего путешествия заселили весь мир. Учитывая распределение в сегодняшней Африке потомков M168 и L3, вполне можно предположить, что они оба жили в Северо-Восточной Африке, в районе современной Эфиопии и Судана. Как и все живущие сегодня люди, M168 имеет общие корни с его африканскими родственниками. Его род представляет собой основную ветвь всей человеческой родословной, включая и ее «терминальные ветви», найденные в ДНК всех сегодняшних евразийцев. И он же соединяет их с африканским корнем нашего вида. В нашей метафоре с деревом каждый маркер, который мы изучаем, это разветвление на дереве — точка, где ствол делится надвое. Если бы у нас не было других маркеров, кроме M168 и L3, наше дерево было бы довольно реденьким и состояло лишь из корня (Адама и Евы) и двух ветвей — одна из них характеризовалась бы маркером M168 или L3 и уходила за пределы Африки, а другая осталась в Африке. К счастью, наше родословное дерево имеет густую крону, которая вычерчивает на карте маршрут нашего путешествия. Интересно, что и на митохондриальной, и на Y-хромосомной ветви сразу после M168 и L3 есть еще одно ответвление, которое разделило евразийскую ветвь на различающиеся кластеры — на два в случае мтДНК и на три в случае Y-хромосомы3. Для Y-хромосомы и мтДНК один их этих кластеров более распространенный, чем остальные — на него приходится около 60% неафриканских ветвей (или родословных линий) в случае митохондриальной ДНК и более 90% в случае Y-хромосомы. Другими словами, большинство живущих сегодня неафриканцев имеют мтДНК и Y-хромосомы, которые принадлежат к наиболее многочисленным кластерам. И живут эти люди во всех уголках Земли, весьма удаленных друг от друга, таких как Европа, Индия и Южная Америка. Однако более редкие линии встречаются только в Азии, Австралии и в обеих Америках. К ним относится большинство митохондриальных и Y-хромосомных типов австралийских аборигенов. Наш редкий митохондриальный кластер получил название M — как руководитель спецслужбы MI6 в фильмах про Джеймса Бонда. А на языке Библии, Ева родила L3, L3 родила М. Согласно недавним исследованиям Луиса Кинтана-Мурси , каталонского исследователя, работающего в Париже, распределение кластера М свидетельствует о ранней миграции людей из Африки, маршрут которой пролегал вдоль побережья Южной Азии до Юго-Восточной Азии и Австралии. М практически отсутствует в странах Ближнего Востока, совсем не обнаружен в Европе, но составляет более 20% митохондриальных типов в Индии и около 100% — в Австралии. Кинтана-Мурси оценил его возраст в 50 000–60 000 лет, и, исходя из его распределения, похоже, elementy.ru/lib/431826/... [стр. 6 ⇒]

Самец или Самка? В двадцати девяти хромосомных парах оба члена пары имеют внешне одинаковую форму. Однако, в тридцатой паре одна хромосома значительно длиннее другой; более длинная называется хромосомой X, а более короткая называется хромосомой Y. Яйцеклетка является носителем X хромосомы, в то время как сперматозоид может иметь как X, так и Y хромосому. Во время клеточного деления при формировании воспроизводительных клеток каждая хромосома пары находится в отдельной гамете. В результате 50% сперматозоидов будут являться носителями X хромосом, а другие 50% будут нести Y хромосомы. Если яйцеклетка по воле случая была оплодотворена сперматозоидом носителем Y хромосомы, то родится самец. Однако эмбрион, несущий две X хромосомы, разовьется в женскую особь (Рис. 6.5). Разделение на мужские и женские особи составляет 50 на 50 в процентном отношении. Очень важно 712... [стр. 120 ⇒]

Африке [246 - Напр., b-глобин, MC1R, PDHA1, Dys44, гаплотипы Y-хромосомы и т. д.]. Это определенно указывает на то, что либо обитатели Евразии получили эти аллели посредством интербридинга с архаичными людьми, либо, что более вероятно, Hss возник не в Африке, а в Евразии. Гаплотипы Гаплотипы имеет не только мтДНК, но и ядерная ДНК. Во время формирования яйцеклетки или сперматозоида пары хромосом (одна отцовская и одна материнская) разделяются на небольшие фрагменты, некоторыми из которых хромосомы обмениваются, после чего эти фрагменты входят в состав перестроенных (рекомбинированных) хромосом. Этот процесс называется кроссинговером (см. Глава 4, разд. Рекомбинация). При этом небольшие участки ядерной ДНК на более мелкие фрагменты не разделяются и наследуются целиком. Такие участки называются «гаплотипами», а группы гаплотипов – гаплогруппами. За счет этого гаплотипы и гаплогруппы сохраняют свою целостность из поколения в поколение таким же образом, как происходящая от матери мтДНК и происходящая от отца Y-хромосома, хотя со временем они тоже накапливают мутации. Всего в каждом индивидуальном геноме насчитывается около 100 000 гаплогрупп, и поскольку гаплогруппы разных популяций накапливают разные мутации, расу индивида можно определить, проанализировав только участки ДНК, где происходили эти мутации. Сравнивая сходство и различия гаплотипов разных популяций, возможно выявить, наиболее древние гаплотипы и определить, насколько они древние. К примеру, имеется несколько вариантов гаплотипа в пределах гена PDHA1. Различные его версии размещаются на дереве, ветвящемся 1,8 млн лет назад и еще раз ветвящемся 200 000 лет назад (Harris, E.E., 1999; Harding, 1999). Но если все люди были одной группой в Африке 65 000 лет назад, как постулирует теория И-и-А, то ныне было бы невозможно существование людей, имеющих версии гаплотипа, дважды ветвившегося до этой даты, но они существуют. И этот гаплотип лишь одна из несостыковок теории И-и-А. Единственный путь объяснить существование этих гаплотипов, сохраняя основу теории И-и-А относительно возникновения современного человека в Африке, это сказать, что древние вариации были приобретены посредством интербридинга с другими древнейшими видами человека, такими как неандертальцы в Европе и эректусы в Восточной Азии. Однако любой существенный интербридинг с другими видами человека лишает обоснованности представление о происхождении современного человека исключительно в Африке. Гаплогруппа D Ядерная гаплогруппа D является еще одной гаплогруппой, создающей проблемы для теории И-и-А. Гаплогруппа D, одна из гаплогрупп ядерной макрогаплогруппы M, обнаруживается у европеоидов и монголоидов, но очень редка или отсутствует у африканцев. Ген в хромосоме 8, кодирующий белок микроцефалин (MCPH1), регулирующий размер мозга в процессе развития, является одним из генов этой гаплогруппы. Гаплогруппа D, как представляется, возникла около 1,1 млн лет назад, возможно, у предков неандертальцев, которые могли скрещиваться с Hss около 37 000 лет назад (Evans, 2006). Она настолько благоприятна, что около 70 % нынешнего населения Евразии имеет ее [247 - Этот процент несколько выше в Европе и Северной Азии и ниже в Южной Азии.]. Гаплогруппы Y-хромосомы Прежде чем закончить рассмотрение ядерной ДНК, давайте взглянем на ядерную ДНК Y-хромосомы. Так как мтДНК передается по женской линии, она картирует разнообразие человечества на Земле, говоря нам о географических перемещениях женщин. Аналогично ДНК Y-хромосомы передается по мужской линии и говорит нам о перемещениях мужчин. Она рассказывает нам не ту же самую историю, что мтДНК, так как мужчины в большей степени, чем женщины, являются первопроходцами новых земель. Мужчины часто переселяются в новые края без своих женщин, а затем женятся на... [стр. 163 ⇒]

3.2. Синдром Каллмана Синдром Каллмана – наиболее частая патология, ассоциируемая с мужским бесплодием и имеющая Х-сцепленный рецессивный тип наследования. У пациентов с синдромом Каллмана выявлена делеция гена KALIG-1, который локализуется на хромосоме Хр22.3 [23]. Различные нововыявленные генные аутосомные мутации также могут привести к развитию синдрома Каллмана [24]. Для пациентов с данным синдромом характерны гипогонадотропный гипогонадизм и аносмия, кроме этого могут иметь место и другие клинические проявления: лицевая асимметрия, волчья пасть, монохромазия, глухота, крипторхизм и аномалии развития надпочечников. Можно относительно легко индуцировать сперматогенез с помощью гормонального лечения [25]. До начала лечения рекомендуется генетический скрининг. Лечение гонадотропинами в подавляющем большинстве случаев может привести к естественному зачатию (даже при относительно низком количестве сперматозоидов в эякуляте), следовательно, выявление пораженного гена (сцепленного с Х-хромосомой аутосомно-доминантного или аутосомно-рецессивного типа) может обеспечить более точное генетическое консультирование, например позволит определить риск передачи генетических нарушений потомству. 4.3.3. Легкая форма синдрома нечувствительности к андрогенам (ЛСНА) Ген рецептора андрогенов (РА) располагается на длинном плече Х-хромосомы. Мутации этого гена могут привести к различным формам синдрома нечувствительности к андрогенам (СНА) – от легкой до полной [26]. Фенотипическими признаками полной формы синдрома нечувствительности к андрогенам (ПСНА) являются наличие женских наружных половых органов и отсутствие волос на лобке (синдром Морриса). Неполная форма СНА имеет различные фенотипические проявления – от преимущественно женского фенотипа, наружных половых органов промежуточного типа до преимущественно мужского фенотипа с микропенисом, промежностной гипоспадией и крипторхизмом. Последний вариант фенотипа носит название синдрома Рейфенштейна. При вышеприведенных тяжелых формах нечувствительности к андрогенам отсутствует риск передачи генетических нарушений в связи с тем, что такие мужчины не могут иметь биологических детей. У пациентов с ЛСНА мужское бесплодие – первичное и иногда единственное клиническое проявление. Дефекты гена РА, вызывающие бесплодие при отсутствии каких-либо других клинических проявлений, – редкая форма болезни. Описано только несколько подобных мутаций у бесплодных мужчин [26–30]. 4.3.4. Другие аберрации Х-хромосомы На Х-хромосоме, особенно на премейотических генах, по сравнению с аутосомными хромосомами было выявлено неожиданно большое количество генов со специфическим для яичек или с обогащенным типом экспрессии, которые были гиперэкспрессированы на Х-хромосоме [31, 32]. К настоящему времени в малых популяционных исследованиях проведен скрининг только по 2 новым генам – USP26 и TAF7L. Связи какого-либо из них с мужским бесплодием выявлено не было (подробнее см. [33, 34]). 4.4. Y-хромосома и мужское бесплодие 4.4.1. Введение Впервые связь между азооспермией и делецией длинного плеча Y-хромосомы, обнаруженной микроскопически, была установлена Tiepolo и Zuffardi в 1976 г. [35]. Сообщения о микроделециях в Y-хромосоме и мужском бесплодии были опубликованы в 1992 г. [36], в дальнейшем был описан еще ряд подобных случаев. Микроделеции были обнаружены в 3 несовпадающих участках Y-хромосомы: AZFa-b-c. Всего через несколько лет после открытия 3 субрегионов AZF, после точного распознавания Y-структуры в Yq11, стало очевидным, что субрегионы AZFb и AZFc накладываются друг на друга, а субрегион AZFd не существует [38]. Делеции, проявляющиеся клинически, захватывают частично или в подавляющем большинстве случаев полностью 1 или более субрегион AZF. Именно они, как правило, представляют собой молекулярно-генетическую основу тяжелой олигозооспермии и азооспермии [39]. В каждом регионе (a, b, c) выявлены разные кандидатные гены, однако их роль в сперматогенезе по большей части остается неизвестной [40]. Так как делеции возникают в нескольких генах, а не в 1, роль гена AZF не может быть достоверно экстраполирована на основании фенотипа AZF-делеции. Поэтому остается неясным, все ли эти гены вовлечены в контроль за сперматогенезом. Геноспецифические делеции, при которых выпадает только 1 ген, обнаруживались только в субрегионе AZFa. Эти исследования позволяют предположить, что ген USP9Y не является необходимым для сперматогенеза и что он, скорее всего, «тонкий настройщик» выработки сперматозоидов [41]. В субрегионе AZFc был описан новый тип Yq-делеций, ему было дано название «gr/gr-делеция» [42]. При этой делеции выпадает половина субрегиона AZGc, что приводит к изменению процента мультикопий генов, расположенных внутри этого субрегиона (таких как DAZ, CDY1, BPY2). 4.4.2. Клинические проявления микроделеций Y-хромосомы Клиническая значимость Yq-делеций долгое время обсуждалась в основном из-за больших различий в их встречаемости по данным различных авторов, а также из-за наличия этих делеций у фертильных мужчин. Сейчас, после более 10 лет клинических исследований, можно заключить, что:... [стр. 16 ⇒]

Полная делеция субрегиона AZFc приводит к различному фенотипу, от азооспермии до олигозооспермии; 6) классическая делеция AZF не связана с повышенным риском крипторхизма или рака яичка (подробнее см. [39]). Специфичность и вышеприведенные генотипические/фенотипические корреляции дают основания для проведения анализа делеций Y-хромосомы в диагностических и прогностических целях при выделении сперматозоидов из яичек [39]. В случае gr/gr-делеции такой четкой корреляции генотип/ фенотип нет. Этот тип частичных AZFc-делеций обнаруживается и у мужчин с нормоспермией, хотя и значительно реже (0,5–1%) по сравнению с мужчинами с нарушенным сперматогенезом. В самом крупном на сегодняшний день исследовании мужчин белой расы было обнаружено, что у носителей gr/grделеций в 7 раз повышен риск развития олигозооспермии [44]. Фенотипические проявления могут варьировать в различных этнических группах в зависимости от состояния Y-хромосомы [45, 46]. Недавний метаанализ исследований, в которых не было отклонений в методологии и отборе пациентов, показал, что общий риск снижения сперматогенеза у носителей gr/gr-делеции равен 2,4 [47]. Также сообщалось, что gr/gr-делеции являются потенциальным фактором риска герминогенных опухолей яичка [48]. Тем не менее необходимо дальнейшее подтверждение этих данных в исследованиях «случай–контроль» с определением влияния этнических и географических факторов. После зачатия делеция Y-хромосомы обязательно передается по мужской линии, поэтому необходимо проводить генетическое консультирование. В большинстве случаев микроделеции у сыновей – такие же, как и у отцов [49–52], но имеются сообщения о том, что у сыновей размер микроделеций более обширен [53]. Существует предположение, что наличие частичных AZFc-делеций (gr/gr и b2/b3) может являться фактором предрасположенности к полной AZFc-делеции в следующих поколениях [54]. Фенотип сыновей может сильно варьировать, и поэтому нельзя точно прогнозировать степень нарушения сперматогенеза (олиго- или азооспермия) из-за различного генетического фона и наличия/отсутствия потенциальных токсических воздействий факторов окружающей среды на сперматогенез. У значительной части сперматозоидов с полной AZF-делецией отсутствует половая хромосома [55, 56], что определяет потенциальный риск развития синдрома Тернера (45,Х0) и других фенотипических нарушений, связанных с мозаицизмом половых хромосом, включая промежуточные половые органы. Скрининг по микроделециям Y-хромосомы у пациентов, имеющих мозаичный 46,XY/45,X0 кариотип с промежуточными половыми органами и/или признаками синдрома Тернера, показал относительно высокую распространенность AZFc-делеции (33%) [57]. Другие данные также позволяют предположить, что микроделеции Yq, могут быть связаны с общей нестабильностью Y-хромосомы, приводя к формированию клеточных линий 45,X0 [58, 59]. Несмотря на этот теоретический риск, дети, рожденные от отцов с микроделециями Yq фенотипически нормальны [39, 60]. Это может быть связано со сниженным уровнем имплантации и более высокой частотой самопроизвольных абортов, если у эмбриона развивается кариотип 45,X0. Мальчики, рожденные после применения ИКСИ у отцов с микроделециями в Y-хромосоме, подлежат диспансерному наблюдению для оценки их фертильного статуса. Также целесообразно проведение криоконсервации сперматозоидов в молодом возрасте. Принимая во внимание тот факт, что только в 1 исследовании сообщалось о повышенном риске развития герминогенных опухолей яичка у носителей gr/gr-делеции, проведение превентивных мероприятий (например, ультразвуковое исследование (УЗИ) яичек) у их сыновей можно будет рассматривать в том случае, если появятся исследования, подтверждающие эту необходимость. 4.4.2.1. Выявление микроделеций в Y-хромосоме Благодаря Клиническим рекомендациям Европейской ассоциации андрологов (ЕАА) [60] и программе внешнего контроля за качеством (http://www.emqn.org/emqn/), тестирование Y-хромосомы становится более гомогенным и доступным в различных генетических лабораториях. Показания для скрининга AZFделеций основываются на количестве сперматозоидов и включают в себя азооспермию и тяжелую олигозооспермию (< 5 млн сперматозоидов/мл эякулята). Клинические рекомендации ЕАА устанавливают праймеры (2 маркера для каждого региона и контрольные маркеры для Yp- и X-хромосомы), которые способны выявить до 85% клинически значимых делеций [60]. Изначально большая вариация в частоте делеций возникла вследствие технических проблем и использования неиспытанных маркеров, а не из-за... [стр. 17 ⇒]

100). Другая хромосома мелкая, напоминает букву Y и содержит сравни6 7 8 9 10 11 12 тельно мало генов. Она названа Y-хромосомой (и г р е к). В клет13 14 15 16 17 18 ках женского организма половые хромосомы одинаковые — две Х-хромосомы. 19 20 21 22 X Y Обозначив аутосомы буквой А, Половые хромосомы Аутосомы (22 пары) можно записать хромосомный набор женщины в виде 44А ХХ, Рис. 100. Набор хромосом человека мужчины — 44А XY. При образовании гамет в каждую из них попадает половина аутосом и одна из половых хромосом. Значит, в женском организме образуется о д и н тип яйцеклеток: все они имеют набор хромосом 22А Х. В мужском организме формируются д в а типа сперматозоидов в равном соотношении: 22А Х и 22А Y. Если яйцеклетку оплодотворяет сперматозоид, содержащий Х-хромосому, из зиготы развивается женский организм. Если в оплодотворении участвует сперматозоид с Y-хромосомой, из зиготы развивается ребенок мужского пола. Следовательно, у человека пол ребенка зависит от типа сперматозоида отца. Поскольку оба типа мужских гамет образуются с одинаковой вероятностью, в потомстве наблюдается расщепление по полу 1 : 1. [стр. 188 ⇒]

Ãåíåòèêà ïîëà Хромосомное определение пола. Чтобы выяснить, чем опре деляется пол, рассмотрим кариотипы некоторых организмов. У самок и самцов большинства существ кариотипы несколько различаются. Например, у дрозофилы 4 пары хромосом. Из них 3 пары у самок и самцов — одинаковые; их назвали аутосома ми. По паре так называемых половых хромосом самки и самцы различаются. У самки в этой паре две палочковидные хромосо мы, обозначаемые как Ххромосомы. У самца в этой паре одна Ххромосома, а другая — сильно изогнутая Yхромосома. Она присутствует только у самца и не имеет пары (гомолога). По ловые хромосомы, кроме генов, определяющих признаки пола, содержат и другие гены, не имеющие отношения к полу. Для того чтобы понять, каким образом в природе поддержи вается равное соотношение полов, рассмотрим мейоз и слияние гамет на примере дрозофилы. При созревании половых клеток в мейозе гаметы получают гаплоидный (одинарный) набор хромосом. В диплоидном наборе самки все хромосомы парные, а значит, все ее гаметы будут иметь одинаковый набор хромо сом. Другое дело у самца: в любой его соматической клетке Х и Yхромосомы присутствуют в единственном экземпляре. После расхождения в мейозе половина гамет будет содержать Ххромосому, а другая — Yхромосому, а следовательно, в потом стве с равной вероятностью будут рождаться мужские и женские особи. Таким образом, пол организма определяется в момент слияния гамет и зависит от хромосомного набора зиготы. У человека в диплоидном наборе 46 хромосом (23 пары). Из них 44 — аутосомы, а две — половые. У женщин это две Ххромосомы, а у мужчин — одна Х и одна Yхромосома. Женский пол человека и дрозофилы, как и многих других ор ганизмов, определяется парой одинаковых хромосом ХХ, а муж ской — двумя непарными хромосомами ХY. Женский пол в этом случае называют гомогаметным, а мужской — гетерогаметным. У некоторых существ наоборот: женский пол гетерогаметен,... [стр. 124 ⇒]

Такую особенность имеют бабоч ки, пресмыкающиеся и птицы. Кариотип петуха — ХХ, кури цы — ХY. Все мужские гаметы таких организмов содержат только Ххромосому, а пол эмбриона определяется тем, какая яйцеклет ка из двух типов будет оплодотворена — с Х или Yхромосомой. Кузнечики и ряд других насекомых не имеют Yхромосомы. У них половина гамет самца (кариотип X0) не содержит ни одной половой хромосомы, а только аутосомы. При слиянии та ких гамет с яйцеклеткой образуется организм, кариотип которо го также имеет только одну половую хромосому, то есть самец. У небольшого количества существ (например, дафний) пол может определяться не хромосомным набором, а внешними условиями. В летний сезон дафнии размножаются партеноге нетически (без участия самцов), и в благоприятных условиях рождаются самки. При возникновении неблагоприятных фак торов в потомстве появляются самцы. Особи некоторых видов рыб, ракообразных, брюхоногих моллюсков и многощетинковых червей меняют пол с возрастом. Чаще самцы с увеличением размеров становятся самками, но бывает и наоборот. Наследование признаков, сцепленных с полом. Если гены, отвечающие за признак, находятся в аутосомах, то наследование признака никак не связано с полом. Его могут наследовать как мужские, так и женские особи. Но если эти гены — в половых хромосомах, то ситуация резко меняется. Для примера рассмо трим наследование черепаховой окраски у кошек с характерным чередованием рыжих и черных пятен. В соматической клетке любого участка тела кошки работает только один ген («рыжий» или «черный»), чередование пятен закладывается случайным образом в эмбриогенезе. Интересно, что котов с черепаховой окраской не бывает. Этот факт оставался непонятным до тех пор, пока не выяснилось, что гены, отвечающие за черепаховую окраску, содержатся в половых Ххромосомах, а в Yхромосомах отсутствуют. Этот тип наследования носит название наследова ния, сцепленного с полом. Обозначим ген черной окраски В, содержащую его хромосо му — Х В, ген рыжей окраски — b, хромо Черепаховая сому — Х b. Гены черной и рыжей окраски кошка аллельные, они расположены в разных гомологичных хромосомах одной пары. Yхромосомы содержат очень небольшое количество генов, в число которых гены окраски не входят. В зиготе возможны следующие комбинации: Х В Х В — черная кошка, Х b Х b — рыжая кошка, Х В Х b —  черепаховая кошка, Х В Y — черный кот, Х b Y — рыжий кот. [стр. 125 ⇒]

С полом оказываются сцепленными и некоторые наслед ственные заболевания, вызванные мутациями генов половых хромосом. Большинство таких нарушений рецессивно, в жен ской особи они могут проявиться фенотипически только в гомозиготном состоянии, когда оба родителя несут в половых Ххромосомах мутантный аллель. С мужскими особями дело обстоит хуже. Мутантные аллели, даже будучи рецессивными, проявляются в фенотипе, поскольку Yхромосома содержит очень мало генов и, как правило, не имеет альтернативных аллелей. При этом признаки, находящиеся у матери в скры той, рецессивной форме, проявляются у мужской особи в виде заболевания. Так передается тяжелая болезнь гемофилия. Кровь больных практически не свертывается. Даже небольшие царапины и ушибы вызывают длительные кровотечения и внутренние кро воизлияния. Это заболевание обусловлено рецессивным геном Ххромосомы и встречается только у мужчин, гомозиготные по рецессивному аллелю девочки умирают в юном возрасте. При сочетании женщины, несущей ген гемофилии в ре цессивной форме, со здоровым мужчиной половина мальчиков будут больными. Девочки, больные гемофилией, практически не встречаются, поскольку вероятность встречи больного муж чины и женщины, несущей ген гемофилии, чрезвычайно мала. Аналогично наследование дальтонизма (неспособности различать зеленый и красный цвет) сцеплено с полом по Ххромосоме. Мужчиндальтоников — 4 %, а женщин — менее 1 %. В редких случаях сцепленное с полом наследование (на пример, одной из форм рахита) носит доминантный характер и поэтому чаще встречается у женщин, в связи с наличием в их генотипе двух Ххромосом. У человека примерно 300 генов Ххромосомы отсутствуют в Yхромосоме. Несколько генов присутствуют в Yхромосоме, но отсутствуют в Ххромосоме, в этом случае наблюдается на следование от отца к сыну. Такой тип наследования называют Yсцепленным голандрическим наследованием. С Yхромосомой связано наследование «рыбьей» кожи, перепончатых паль цев, избыточного волосяного покрова на ушах. Именно при... [стр. 126 ⇒]

После установления линейной дискретности хромосом возникла необходимость составления цитологических карт с целью сопоставления с генетическими, составленными на основе учета рекомбинаций. Цитологическая карта — это карта хромосомы, на которой определяется расположение и относительное расстояние между генами в самой хромосоме. Построение их ведется на основе анализа хромосомных перестроек, дифференциальной окраски политенных хромосом, радиоактивных меток и др. К настоящему времени, у ряда растений и животных построены и сопоставлены генетические и цитологические карты. Реальность этого сопоставления подтверждает правильность принципа о линейном расположении генов в хромосоме. У человека можно назвать некоторые случаи сцепленного наследования: 1. Гены, контролирующие наследование групп крови по системе АВ0 и синдрома дефекта ногтей и коленной чашечки, наследуются сцепленно. 2. Сцеплены гены резус-фактора и овальной формы эритроцитов. 3. В 3-й аутосоме расположены гены группы крови Лютеран и секреции антигенов А и В со слюной. 4. Гены полидактилии и катаракты наследуются сцепленно. 5. В Х-хромосоме расположены гены гемофилии и дальтонизма, а также гены цветовой слепоты и мышечной дистрофии Дюшена. 6. В 6-й аутосоме находятся сублокусы А, В, С, D/DR системы HLA, контролирующие синтез антигенов гистосовместимости. 7.3 Наследование признаков Х-сцепленных и голандрических Признаки, контролируемые генами, расположенными в половых хромосомах, называются сцепленными с полом. У человека описано более 60 заболеваний, сцепленных с полом, большинство из которых наследуются рецессивно. Гены в половых хромосомах можно разделить на 3 группы: 1. Гены частично сцепленные с полом. Они расположены в парных сегментах Х и Y хромосом. К заболеваниям, частично сцепленным с полом, относят: геморрагический диатез, судорожные расстройства, пигментный ретинит, пигментную ксеродерму, общую цветовую слепоту. 2. Гены полностью сцепленные с полом. Они расположены в участке Х-хромосомы, для которого нет гомологичного участка в Y-хромосоме (гетерологическом). Эти гены контролируют заболевания: атрофия зрительного нерва, мышечная дистрофия Дюшена, дальтонизм, гемофилия, способность ощущать запах синильной кислоты. 3. Гены, расположенные в участке Y-хромосомы, для которого нет гомологичного локуса в Х-хромосоме, называются голандрическими. Они контролируют признаки: синдактилия, гипертрихоз ушной раковины. Ген дальтонизма проявляется у 7 % мужчин и у 0,5 % женщин, но но65... [стр. 65 ⇒]

Теперь известны цитологические основы чистоты гамет - это мейоз, при котором гомологичные хромосомы распределяются по гаметам. Соотношение 3:1 является статистическим, т.е. выполняется с достаточной точностью только для больших выборок организмов. Для выполнения этого соотношения требуется также хорошее "перемешивание" аллельных генов, которое обеспечивается случайной встречей гамет при оплодотворении. Скрещивание, при котором организмы отличаются друг от друга двумя парами признаков, называется дигибридным, тремя - тригибридным и т.д. Третий закон Менделя правило независимого комбинирования генов - гласит: гены различных аллельных пар и соответствующие им признаки передаются потомству независимо друг от друга, комбинируясь во всех возможных сочетаниях. В случае n-гибридного скрещивания получается 3n разных генотипа, которые распределены по 2n фенотипическим классам, однако по каждоой паре аллельных признаков сохраняется (при полном доминировании) расщепление в соотношении 3:1. Выполнение этого закона обеспечивается тремя перемешивающими гены последовательно происходящими случайными процессами при кроссинговере - случайным обменом участками между гомологичными хромосомами в пахитене Профазы I мейоза, случайным расхождением гомологичных хромосом по дочерним клеткам, случайной встречей гамет при оплодотворении. Из-за одного только случайного распределения гомологичных хромосом каждый человеческий организм способен образовать 223 ~ 8.67106 генетически различных гамет. Кроссинговер и случайная встреча гамет неизмеримо увелисчивают разнообразие генетических комбинаций. Комбинирование родительских генов в потомстве является разновидностью наследственной изменчивости, которая называется комбинативная изменчивость. Однако закон независимого комбинирования генов достаточно хорошо выполняется только для тех пар признаков, гены которых находятся в негомологичных хромосомах или в гомологичных хромосомах, но на большом удалении друг от друга, так что кроссинговер между ними происходит очень часто. Если гены находятся рядом в одной хромосоме, то разделяющий их кроссинговер будет редким явлением, и такие гены будут, как правило, наследоваться совместно. Это явление получило название сцепленного наследования генов и подчиняется закону Моргана: гены, локализованные в одной хромосоме, наследуются сцепленно, причем сила сцепления зависит от расстояния между генами. Если в трех парах генов определить частоту кроссинговера в %, то частота кроссинговера между какими-либо двумя из них, например, А и С, близка к сумме или разности величины кроссинговера в паре А и В и в паре В и С, т.е. AC% = AB% + BC% или AC% = AB% - BC%. Эта закономерность находится в полном соответствии с обычной геометрической зависимостью в расстояниях между точками на прямой линии и явилась первым доказательством линейной последовательности расположения генов в хромосоме. Частота кроссинговера может достигать 50%, но никогда не превышает этой величины, т.к. при больших расстояниях между генами происходит дополнительный обмен участками, т.е. двойной, тройной и т.д. кроссинговер. При этом часть первоночальных перекрестов остается неучтенной, что приводит к общему снижению процента кроссинговера. Расстояния между генами, найденные как частоты кроссинговера, послужили основой для составления первых генетических карт организмов. Х-хромосома намного длиннее, чем Y-хромосома, и содержит некоторые гены, которых нет в Y-хромосоме, в том числе и гены, кодирующие не связанные с проявлением пола белки. Такими генами определяются признаки, сцепленные с полом, и они могут передаваться потомству только с X-хромосомой. Гены, расположенные в половых хромосомах человека, можно разделить на три группы (рис. 166): 1) гены, расположенные в том участке, который является одинаковым у X- и Y-хромосом и проявляющие лишь частичное сцепление с полом (нарушаемое кроссинговером); 2) гены, расположенные в... [стр. 162 ⇒]

Наследование, сцепленное с полом. Аутосомы, составляющие одну гомологичную пару, совершенно подобны друг другу. Половые хромосомы или гетерохромосомы могут сильно различаться между собой как по морфологии, так и заключенной в них генетической информации. У человека 23 пары хромосом: 22 пары – аутосомы и одна пара – половые хромосомы. Сочетание половых хромосом в зиготе определяет пол будущего организма. Большую из хромосом этой пары называют Х-хромосомой, меньшую – Y-хромосомой. У некоторых животных Y-хромосома отсутствует, у всех млекопитающих ( в том числе у человека), у дрозофилы и многих других животных женские особи в соматических клетках имеют две Х-хромосомы, а мужские – Х- и Y-хромосому. У этих организмов все яйцеклетки одинаковые, они содержат Ххромосомы. Сперматозоиды у них образуются двух типов. Одни содержат Ххромосому, другие – Y-хромосому. Поэтому при оплодотворении возможны две комбинации: 1. Яйцеклетка, содержащая Х-хромосому оплодотворяется сперматозоидом с Ххромосомой. В зиготе встречаются две Х-хромосомы, из этой зиготы развивается женская особь. 2. Яйцеклетка, содержащая Х-хромосому оплодотворяется сперматозоидом, несущим Y-хромосому. В зиготе сочетается Х- и Y-хромосомы. Из этой зиготы развивается мужской организм. Таким образом, сочетание половых хромосом в зиготе, а следовательно и развитие пола ( у человека, млекопитающих, дрозофилы) зависит от того, каким сперматозоидом будет оплодотворено яйцо. Сперматозоидов с Х- и Y-хромосомой примерно одинаковое число, поэтому особей обоего пола рождается примерно поровну. У птиц, бабочек, некоторых пресмыкающихся женские особи имеют разные половые хромосомы, а мужские – одинаковые. Так, у петуха в соматических клетках содержатся две Х-хромосомы и все сперматозоиды его одинаковые. Курицы наряду с Х-хромосомой несут Y-хромосому. Поэтому яйца бывают двух типов: у прямокрылых (класс насекомые) Y-хромосома отсутствует. В этом случае гаметы самца несут либо Х-хромосомы, либо ничего не несут. [стр. 20 ⇒]

Слияние сперматозоида 22+Х с яйцеклеткой 22+Х даст начало женскому организму. Слияние сперматозоида 22+Y с яйцеклеткой 22+Х даст начало мужскому организму. Y-хромосома представлена во всех ядрах клеток мужского организма. При мейозе Y-хромосома рекомбинирует с Х-хромосомой. Участок Y-хромосомы, гомологичный с Х-хромосомой, расположен на концах Y-хромосомы (псевдоаутосомный регион и теломера) и занимает около 5% её длины. Приблизительно 95% Y-хромосомы не имеют гомологичных участков и не рекомбинируют. В этих участках локализуются гены, функционирующие только в мужском организме. Y-хромосома содержит около 200 генов, среди которых 72 гена кодируют белки. Признаки, наследуемые с Y-хромосомой, называют голандрическихми. Нерекомбинантные гены Y-хромосомы, присутствующие на Х-хромосоме AMELY/AMELX (амелогенин) RPS4Y1/RPS4Y2/RPS4X (рибосомный белок S4) Нерекомбинантные гены Y-хромосомы, отсутствующие на Х-хромосоме AZF1 (азооспермии фактор 1) BPY2 (основной белок Y-хромосомы) DAZ1 (удаляется при азооспермии) PRKY (Y-сцепленная протеин киназа) SRY (регион, определяющий пол) TSPY (специфичный для яичка белок) ZFY (белок цинковых пальцев) Аксонема Движение жгутика сперматозоида и ресничек мерцательных клеток обеспечивает тубулин-динеиновый хемомеханический преобразователь (тубулиновый молекулярный мотор) в составе аксонемы. Аксонема формируется путём самосборки. Матрицей для сборки служит центриоль или базальное тельце. Аксонема (рис. 4-2) состоит из 9 периферических пар микротрубочек и двух расположенных центрально одиночных микротрубочек. В каждой периферической паре различают субфибриллу А, содержащую 10–11 тубулиновых протофиламентов, и субфибриллу В, содержащую 13 протофиламентов. Смежные пары микротрубочек соединены между собой эластичным белком нексином. С субфибриллой А связаны наружные и внутренние ручки. В их состав входит белок дине... [стр. 8 ⇒]

Смотреть страницы где упоминается термин "Y-хромосома": [163] [16] [29] [22] [38] [25] [88] [160] [130] [140] [232] [9] [6] [48] [41] [70] [81] [6] [11] [5] [26] [42] [18] [7] [3] [4] [77] [180] [27] [29] [35] [50] [66] [365] [7] [46] [34] [178] [203] [10] [456] [1] [3] [36] [41] [46] [50] [145] [146] [151]